Open Access

Development and evaluation of a cucumber TILLING population

  • Rina Fraenkel1,
  • Irina Kovalski1,
  • Christelle Troadec2,
  • Abdelhafid Bendahmane2 and
  • Rafael Perl-Treves1Email author
BMC Research Notes20147:846

https://doi.org/10.1186/1756-0500-7-846

Received: 20 July 2014

Accepted: 18 November 2014

Published: 26 November 2014

Abstract

Background

Ordered collections of mutants serve as invaluable tools in biological research. TILLING (Targeting Induced Local Lesions IN Genomes) provides an efficient method to discover, in mutagenized populations, the possible phenotypes controlled by gene sequences whose function is unknown. This method can replace transgenic techniques for the functional validation of cloned genes, especially in the case of transformation-recalcitrant plants such as cucumber.

Results

We report the development of a TILLING cucumber population, generated by EMS mutagenesis in the Poinsett76 genetic background. The population was evaluated by screening for morphological mutations, and a range of developmental, pigmentation and spontaneous lesion mutants were observed. Suitability for detecting single nucleotide polymorphism in selected genes has been tested by screening a sample of amplicons, with detection rate of 1 SNP in ~1 Mbp.

Conclusion

The population described in this Research Note represents a useful asset in cucumber research, to be exploited for forward genetic screens and functional genomics purposes.

Keywords

Cucumis sativus EMS mutagenesis Mutant screen TILLING

Background

Reverse genetic strategies are required to attribute a function, or phenotype, to the wealth of genes whose sequences are known, but their precise role in metabolism or development is unknown. The most common reverse genetic methods in plants involve T-DNA insertions or RNAi silencing, however, both methods require an efficient plant transformation platform and long term efforts to generate large arrays of transgenic lines. TILLING (Targeting Induced Local Lesions IN Genomes) is a relatively inexpensive, non-transgenic technique for interrogating the function of a given sequence; it is suitable for any species, regardless of genome size [13]. To generate a saturated TILLING population, wild-type seeds are typically treated with EMS (ethyl methanesulfonate), a mutagen that saturates the genome with point mutations, mostly G/C to A/T transitions [4]. The treated seeds are germinated, and the resulting M1 plants self pollinated to collect M2 seeds. DNA samples from mutagenized seed pools are screened by PCR amplification of the gene of interest, followed by digestion with an endonuclease that cleaves at mismatched sites. If a particular M2 family carries a point mutation in the amplified fragment, heteroduplex DNA carrying a mismatch at the mutated site will form during replication of mutant and wild-type alleles present together in the particular family-sample. Genetic analysis of the segregating family, i.e., sequencing individuals from the suspect family and their phenotypic inspection, allows the discovery of mutant phenotypes and sheds light on the gene’s function.

In a TILLING population, mutations are spread randomly in the genome; a spectrum of mutated alleles, including weak ones that are desirable for studying essential genes, can be obtained, and can even be used to infer structure-function relations of the encoded protein [5, 6]. The method has been refined by Bendahmane and co-workers for different crops, including Cucumis melo, the melon [7, 8]; see also [9], pea [10] and tomato [5]. The use of an Arabidopsis endonuclease, ENDO-1, rather than the commonly used CEL-1 nuclease from celery, rendered the screening of molecular mismatches particularly efficient [7, 11, 12].

Cucumber (Cucumis sativus) is a species of economic importance, whose genome has been sequenced recently [1315]. However, being transformation-recalcitrant, functional genomics studies in cucumber have lagged behind. Here we report on a TILLING population that could enhance the cucumber genomic toolkit for future research. Studying a sample of the population, we show the range of morphological mutations that is seen, and demonstrate the occurrence of nucleotide substitutions in a few gene fragments.

Results and discussion

Mutagenesis and multiplication

To select the optimal EMS concentration that is likely to produce many mutations but will not heavily affect germination and fertility, we performed two calibration experiments, in which seeds of cucumber ‘Poinsett76’ were exposed to 0–2.5% EMS. Figure 1 displays the results of an experiment, in which 100 M0-seed aliquots were treated with five concentrations (0, 1, 1.5, 2, 2.5% EMS, respectively). Germination rates were recorded and ranged between 95% (untreated seeds) and 80%, being moderately affected by the mutagen. We also recorded the rate of seedlings exhibiting somatic mutations, i.e., leaf distortion and mosaicism (dark/light variegation) on the first and second true leaves. Such rates increased gradually from 3% total ratio of apparent abnormalities in untreated seedlings, to 97% and 100% in the 2% and 2.5% treatments, respectively. We selected 1.5%-2% EMS as optimal concentrations that mildly affected germination but had a substantial proportion of visible somatic damage. Sub-samples of these plants were grown further and we noted that in most plants the new leaves that developed were normal, and the mosaic symptoms recorded in the first leaves did not extend to subsequent leaves. Apparently, the somatic mutations did not affect the shoot apical meristem but only the first and second leaf-primordia in the mutagenized seed; only a small proportion displayed persistent mutations at the M1 generation. A similar recovery of melon M1 plants from growth inhibition following 1-2% EMS mutagenesis was reported by Dahmani-Mardas et al. [8]. For pea, however, a lower 0.25% concentration (20 mM) was selected [10], with less than 30% of the plants setting seeds at higher concentrations; in Arabidopsis, high mutation rates were achieved by 0.25-0.5% EMS [16] and the authors suggested that DNA repair mechanisms could be responsible for inter-specific differences in mutation yields.
Figure 1

Calibration of EMS treatment. Aliquots of 100 seeds were treated with 0, 1, 1.5, 2 and 2.5% EMS and sown in germination trays. Percent germination was recorded after 9 and 16 days, and seedlings exhibiting somatic mutations in the cotyledons, first and second true leaf were counted and expressed as percent of the fully germinated seedlings. Mutations included smaller or distorted cotyledons or leaves, as well as dark–light leaf patterns. Standard errors of the percentage of the final germination or mutated seedlings rates was computed as 100× [b × (1-b)/n]0.5, where b is the proportion of a given class, and n – the total number of plants [17].

Thirty seedlings from the 1%, 1.5% and 2% treatments were transferred to the greenhouse for further growth and fertility assessment. We concluded that fertility following self pollination was similarly good at all three EMS concentrations, with 87% of the plants treated with either 1.5% or 2% mutagen producing >100 seeds. This agrees with Dahmani-Mardas et al. [8] who reported that 3% EMS, but not 1-2%, significantly affected melon fertility.

To produce the TILLING population, we applied 1.5 or 2% EMS to Poinsett76 cucumber seeds in three different batches. A total of 1200 M1 plants were grown to full maturity in a farmer’s net-house in Netiv Ha’asara, Israel Southern coastal region, and in Bar-Ilan University net-house, and self-pollinated to collect M2 seeds. This resulted in ~1000 M2 families with adequate yield of 50–300 seeds. Six seedlings per M2 family were germinated, and a mixed DNA sample from four of them was prepared. The first 768 families were arranged in 96 well plate wells (see Methods) and used to evaluate the population.

Phenotypic evaluation of the population

We utilized the M2 seedling samples (6 individuals per family) grown for DNA extraction to record mutant phenotypes that were observable at the cotyledon and first leaf stages. Whereas we cannot exclude that some phenotypes could be due to environmental variation or seedling physiology – especially differences in size or germination ability - in many cases, the phenotype was apparent in two individuals of the same family, demonstrating the likely heritability of the putative mutation. Table 1 summarizes the phenotypes that we recorded and Figure 2 provides several examples. The most frequent seedling phenotypes included post-germination lethality, dwarfism, and spontaneous lesions in the cotyledons. The latter class was unlikely to result from response to pathogens in the growth chamber, as it appeared sporadically, often with two seedlings per family showing the lesions while the rest of the sample and the adjacent seedlings in the tray lacked them. Such mutations could identify genes involved in disease-resistance signaling. Mutants with distorted cotyledons and/or leaves, albino cotyledons and yellow or mosaic-yellow leaves were also apparent, as well as taller seedlings, dark-narrow and fused cotyledons. In total, 10% of the families exhibited a morphological alteration.
Table 1

Major mutant phenotypes recovered by visual screening of the TILLING population at the seedling stage

Phenotype

No. of families displaying phenotype

Description

Representative family

Seedling lethality

19

Seedling dies, or fails to develop a root after germination

144, 157

Dwarf

10

Cotyledons smaller, short hypocotyl

422

Necrotic lesions

15

Spontaneous necrotic spots appear on cotyledons

38

Albino

3

White cotyledons

164

Yellow leaf

7

True leaves pale-green or yellow, or mosaic green and yellow

218

Tall seedlings

5

Hypocotyl >2 cm taller than wild type

180

Glabrous

1

Cotyledons lack trichomes

16

Non-serrated leaf

3

Leaf edge appears smooth

189

Dark, narrow cotyledon

1

Dark green, narrow cotyledons

411

Fused cotyledons

1

Cotyledons fused together

714

Small leaf

7

True leaf very small

17

Distorted leaf/cotyledon

5

Irregular organ shape

160, 213

Total mutants/ families screened

77/768

  

Six seedlings per M2 family were sown in trays and inspected at the cotyledon-first true leaf stage. The number of families and examples of specific families that segregate for a given phenotype-class are indicated. About 10% of the families exhibited morphological alterations at the seedling stage.

Figure 2

Selection of morphological mutations segregating in M 2 mutated families at the seedling stage. Family 164: albino cotyledons, green leaf. Another mutation for pointed cotyledons seems to segregate as well. Family 411: dark, seemingly anthocyanin-enriched, narrow cotyledons. Family 38: spontaneous necrosis of cotyledons and leaf. Family 218: yellow-light green pigmentation. Family 147: dwarf phenotype, small dark cotyledons.

Several seedlings that exhibited prominent abnormalities were grown to maturity, and outstanding phenotypes could be seen among the mature plants as well. These included persistent virescent or yellow-leaf character (Family 424), a fasciated plant with floral organ abnormalities and organ-fusions (Family 176), and more; Figure 3 provides a few examples. This demonstrates that the population is a rich source of morphological and developmental mutations that could be tapped using forward-genetic schemes. Since each M1 plant and the descendant M2 family harbors multiple point mutations, genetic analysis will be required to discern them and correlate a specific mutant phenotype with a single molecular event.
Figure 3

Selection of morphological mutants at the mature plant stage. Family 38: deeper-lobed leaf (right, compared to wild-type leaf on the left), and smaller male and female flowers (bottom, compared to wt flowers on top). Family 424: pale green plant. Family 164: darker leaf with shallow lobes (left, compared to wt leaf on the right). Family 176: fasciated, sessile inflorescences with reiterated organs, multiple petalled flowers and a branched ovary. Family FX: “cauliflower” mutant with arrested-development, reiterating, inflorescence with dense trichomes and a lanceolate leaf.

Molecular evaluation of test-genes

To check whether we could interrogate our population with a given gene sequence and recover point mutations in selected gene fragments, we chose six genes that yielded visible phenotypes when mutated in other plants. Primers were designed to amplify the more conserved parts of the coding sequence; in some cases, intronic sequences were also included. Figure 4A depicts the amplification scheme of four genes, for which point mutations were recovered. Table 2 specifies the primers that were used.
Figure 4

Screen for nucleotide substitutions in selected gene fragments. A. Gene model and amplification schemes of the cucumber phytoene desaturase-3 gene, Female ACC synthase, ramosus-3 and ramosus-4 homologous genes. The approximate positions of the amplicons screened by TILLING are indicated, each delimited by two pairs of nested primers (arrows indicate the internal amplicons). The mutations that were verified by sequencing (from families 53, 254, 48, 540, 928) are indicated; in family 53, two independent point mutations were recovered in two of the genes, respectively. B. Chromatogram of the C to T mutation (read by a reverse primer as G to A), discovered in the PDS-3 gene, in family 53. Top: wild type sequence in cultivar Poinsett76. Below: plant 53–13 is homozygous for the mutation, plant 53–20 is heterozygous.

Table 2

Primer pairs used to generate amplicons for the TILLING screen of six genes, as detailed in the methods

Gene

Amplicon

External primers

Internal primers (M13 tag bold)

PDS-3

pdsB

Pds3for1, CACAGATGACATTCTTCCCAAT

pds3for3, CACGACGTTGTAAAACGAC TCTAACATACCCATAGG

Pds3rev2, CCTAGTTCTACCCTTTGTTCTTGG

pds3rev4, ATAACAATTTCACACAGG GTTTCATGCTGGCTGCC

 

pdsD

Pds3for5, GGAAATTTGTCTCAACATGTGTGC

Pds3for7, CACGACGTTGTAAAACGAC TCTCCAAACTAGTGAC

Pds3rev6, CTTGTGCCACATGGCTAGAATAG

Pds3rev8, GATAACAATTTCACACAGG CTGCCGGTGATGCTGG

 

pdsF

Pds3for9, AAGGGGCTCGACTGTTCAGAAA

Pds3for11, CACGACGTTGTAAAACGAC CACTAGAAGACTCAGC

Pds3rev10, CTGGTAGTGATTCTCGGTTTCA

Pds3rev12, GATAACAATTTCACACAGG CATCCACCGAAGTAGA

Female

acsA

AcsFor1, GAACTATCTACCATATTCCAACC

AcsFor2, CACGACGTTGTAAAACGAC GTACCTATATACCTCACCTCAACAT

AcsRev3, CACCAACTCGAAAACCTGGGAGCC

AcsRev1, GGATAACAATTTCACACAGG CCTCGTCTTCGTTACTCCTCTCCT

 

acsB

AcsFor5, TTGATAGAGATTTGAAATGGAGA

AcsFfor6, CACGACGTTGTAAAACGAC CCGGAGTTGAGATTGTGCCAATTC

AcsRev7F, CCGAGTGCACTTTTCTTTTTC

AcsRev5, GGATAACAATTTCACACAGG ATTCCCCCAAATATGGATGATG

RMS-3

rms3A

Rms3for1, GTGTCACCGTGCATGCAATTGCCG

Rms3for2, GTACACTTCAAATCATAAACGGCTG

Rms3Rev2, TTCATCTCTCAGTTTTCCTACCTAAT

Rms3Rev1, GGGTTACAAACGCTGGCCTTC

 

rms3B

Rms3for6, ATTGCAAACATAGCCATCAAAATC

Rms3for7, GTCAAAATTATCATTTCTACGCAGG

Rms3rev6, CAAGTAAAAACACAGCTCTCAACCT

Rms3Rev5, GAGTGGATGCTATTCCTTTTCGATG

RMS-4

rms4A

Rms4for5, CTCTCTCCGTTGCTAAGACAAACCC

Rms4for1, TCCGATTACTGTATCTTCCTGCTCG

Rms4rev6, CAAACTCACCATTGTTCTCAAACCC

Rms4rev1, CGACAGCGATTCAAGCCCTTGACAA

 

rms4B

Rms4For4, TTCTCGTGGCCAATCCTCTGAC

Rms4for2, CCATTACCGAGGCTTGCCCTAACCT

Rms4rev5, GCCCCACAAATCATTACCACTGCAT

Rms4rev2, GCCCCACAAATCATTACCACTGCAT

 

rmsC

Rms4G3for7, GGATGGAAACTATGGTGGATATA

Rms4for3, CCAGGTACTCCACCGACGCTGATTG

Rms4G3rev7, CCCATGAAAGATTGTGAAATCACA

Rms4rev3, GTGATACAGCTAATCTCAAAGTAAC

Cum-1

Cum1B

Cum1for1, GCTCTTTTCCTCATCAGGTTAGTG

Cum1for3, ACGACGTTGTAAAACGAC TCTCCTGCTCATTCCAC

Cum1rev2, GTATACACCAAACTGAGAACCAG

Cum1rev4, GATAACAATTTCACACAGG TACAACCCAGATTCCC

 

Cum1D

Cum1for5, GATATCAATTAAACCATGCGGGC

Cum1for7, CACGACGTTGTAAAACGAC TGGTATGAAATGGGGG

Cum1rev6, GATTATCGGTTTCATCTCCATGG

Cum1rev8, GATAACAATTTCACACAGG CCCAATTCAGACCTTC

SP

spB

SPfor1, GGACAGCACAAGAAAAGGTCAC

SPfor2, CACGACGTTGTAAAACGAC TGCCTCTCTCTCTGCT

SPrev1, CACATCATTTCTTGCCAATTGTC

SPrev2, GATAACAATTTCACACAGG GGGCATCTTTTGCAAC

 

spC

SPfor1, GGACAGCACAAGAAAAGGTCAC

SPfor3, CACGACGTTGTAAAACGAC CAACCAATTCCCAAAC

SPrev1, CACATCATTTCTTGCCAATTGTC

SPrev3, GATAACAATTTCACACAGG CACTCTCTCTCACCAG

The bold portion of the internal primers corresponds to the M13 tail that binds a third pair of universal primers that were fluorescently labeled. The corresponding internal primers of Rms-3 and Rms-4 were directly labeled.

Cucumber phytoene desaturase-3 (Pds-3), gene accession number Csa002881, encodes a carotene biosynthetic enzyme. Inactive alleles could give rise to an albino phenotype [18]. We screened three amplicons and identified four mutated families, two in amplicon B and two in D. We sequenced and verified the mutations in families 53 and 254, and each carried a different C-to-T substitution. In family 254, three plants were heterozygous and two had the wild type allele; in family 53, two were wild-type, two homozygous for the mutation and four were heterozygous (Table 3, Figure 4). All four mutations mapped to introns present in the amplicons, and no mutant phenotypes were observed. This underscores the importance of targeting exons and avoiding introns when performing a TILLING screen.
Table 3

Nucleotide substitutions recovered in query genes by TILLING screen

Gene

Amplicon

Amplicon size, bp

% GC content

% Exons

Mutated family

SNP

Diagnostic CAPS

Location/substitution

M3 Progeny analyzed: WT/WT : Heteroz.: mut/mut

Phytoene desaturase-3 (PDS-3), Csa002881

pdsB

622

36.5

55

53

C5310T

 

Intron 8

2 : 4 : 2

   

188

nd

 

Intron 8

nd

pdsD

1198

34.5

23

254

C3997T

-

Intron 6

2 : 3 : 0

   

70

nd

 

Intron 6

nd

ACC synthase (F), Csa012150

acsA

1111

39

70

none

-

-

-

-

acsB

1025

41

96

48

C594T

Dra I

Intron 2

4 : 9 : 5

Ramosus-3 (RMS-3), Csa010158

Rms3A

513

47

72

none

-

-

-

-

Rms3B

639

43

70

540

G1376A

-

Gln191Gln

3 : 4 : 0

Ramosus-4 (RMS-4), Csa003326

Rms4A

1222

51

86

53

C767T

-

Thr256Ile

3 : 10 : 3

Rms4B

929

46

100

928

C1258T

Sac I / Xba I

Leu420Leu

7 : 7 : 0

Rms4C

798

45

84

none

-

-

-

-

Cucumber MADS1 (Cum1), Csa000681

Cum1B

575

35

41

none

-

-

-

-

Cum1D

702

34

30

none

-

-

-

-

Self-pruning (sp), Csa010707

SpB

704

29.8

39

none

-

-

-

-

Total

 

10,766

39.7

63

8

    

Genes are indicated by name and by accession numbers (cucumber genome project, http://cucumber.genomics.org.cn). Amplicon size (calculated between internal primer pairs) is shown, as well as the GC composition and the ratio of coding sequence (exons) to total amplicon length. Mutated position is determined according to the genomic sequence, from the start codon (ATG), and its location, either in an intron or in the protein coding-sequence, is indicated. Nd – non determined. CAPS marker in ACC synthase gene: the wild type amplicon is digested by Dra I, mutant amplicon is uncut. CAPS marker in RMS4: wild type amplicon is digested by Sac I (and also Xba I), no restriction in the mutant. A small number of M2 progeny was genotyped to demonstrate inheritance of the nucleotide substitution. The total sequence screened (10,766 bp) was calculated by summing up all the internal amplicons, and detracting the overlapping regions found between the Acs (F) and Rms-4 amplicons (see Figure 4).

The Female sex-determining gene encodes an ACC synthase enzyme that controls the differentiation of female flowers and abolishes male flowers [19]. We detected a single nucleotide substitution in our screen that segregated in the expected 1:2:1 ratio, and mapped it to intron 2 of the gene (Table 3, Figure 4A). As expected from its intronic location, the mutation had no phenotypic effect.

Ramosus-3 and Ramosus-4 are genes that affect apical dominance and were extensively studied in pea, as well as other plant species [20]; rms mutants often show extensive branching. We designed and screened amplicons for each gene, and recovered one mutant in rms-3 and two in rms-4. All three substitutions mapped to the coding sequence (Table 3, Figure 4A). Two of them involved silent mutations and no phenotype was observable. The third mutation, in the single large exon of the gene (Family 53) caused a threonine-to-leucine substitution. In the M2 generation, we did not observe progeny with increased branching, or other phenotype that we could associate with certainty with the Thr256Ile substitution. We have analyzed the respective protein sequence using SIFT (Sorting Intolerant From Tolerant, [21]) and found that substituting Thr to Ile at this position is predicted to be tolerated and thus, unlikely to affect the phenotype. In addition to the above four genes, we screened also a cucumber homolog of the tomato self-pruning gene for determinate growth habit (cucumber sp, Csa010707) and a MADS box homolog, CUM-1 (Csa00068; Tables 2 and 3), but no mutations were recovered for these two genes.

We have recovered, by screening six genes, in a 768 families-sample of the population (of the ~1000 presently available), a total of 8 mutants, 6 of which were confirmed by sequencing the M2 progeny; the other two were estimated to be in the intron, judging from their endonuclease product sizes, and were not analyzed further. The mutations were recovered by screening 13 amplicons that totaled 10,766 nucleotides (Table 3). The average mutation frequency in the collection is, therefore, 8 mutations per 10,766 × 768 bp of sequence screened across the population, i.e., 1 in 1.03 Mbp. If we ignore amplicon borders, where endonuclease digestion would pass undetected, frequency would be 1 mutation in 859 kb. Such density is fair, albeit lower than the density observed by for pea (1/200 kbp, [10]), Arabidopsis (1/300 kbp, [16] and melon (1/573 bp, [8]); it is similar to the observed rate in barley (1/1 Mbp, [22]) and allows for Reverse Genetics screening of the population. In a parallel study, another TILLING population has been prepared in the cucumber ‘Beit-Alpha’ background, and a similar mutation density (1/1.14 Mbp) was recovered [23].

In the amplicons that we screened, we could compare SNP rates in exons (comprising 60% of the amplicons) vs introns (40%). Of the eight mutations, five were located in introns and three in exons. Of the six sequenced mutations, five were C to T, and one was a G to A transition, which are the two common products of EMS mutagenesis [16]. The ratio of intronic mutations exceeded the ratio of exonic ones by a factor of 2.5 (= 60/40 × 5/3). Moreover, two of three exonic mutations were silent; it has been estimated that about half of the non silent (missense) mutations are likely to affect protein activity [24]. Thus, if one wishes to recover mutated alleles with a higher probability of affecting the phenotype, population size should be increased to ~3000 plants and inclusion of introns in the amplicons screened should be minimized, although, when exons are small, introns are hard to avoid. The present SNP sampling was not aimed at recovering mutant phenotypes, the goal being a mere assessment of DNA-level mutation rates.

By sequencing a small sample of progeny of mutated families in the M2 generation we confirmed the Mendelian inheritance of the nucleotide substitutions. In two cases we facilitated screening by developing a diagnostic CAPS marker. In three cases we did not recover the homozygous-mutant class (Table 3). Since we did not expect the respective mutations to be lethal (none of them affects the protein product of the gene), this segregation could be due to the small sample of progeny, or to pollination of a heterozygous mutant plant with wild-type pollen; this, in turn, could result from out-crossing with a neighbor plant, or from a chimeric plant composition following seed mutagenesis. In such cases, self pollinating of heterozygous individuals can readily provide the desired homozygous mutants.

Conclusions

A cucumber mutant population in the Poinsett76 background was successfully constructed using 1.5-2% EMS treatment. It provides a rich source for morphological mutant phenotypes that can be recovered by forward genetic screens. It can also be efficiently screened by the reverse genetics TILLING approach, to recover mutations in target genes. With the entire cucumber genome sequence available, our study thus provides a valuable tool for functional genomics in cucumber. Data and seeds for collaborative research can be obtained by agreement from the corresponding author.

Methods

Preparation of the TILLING population

Poinsett76 cucumber seeds were incubated at room temperature for 15 hrs, in 3 volumes of freshly-prepared EMS solution (Sigma M0880), in 0.2 M phosphate buffer (pH = 7), with gentle stirring. After extensive washing (5 × 30 min in tap water at room temperature with stirring), seeds were sown in “Speedling” germination trays and transplanted in 10 L pots in the greenhouse at the 2–3 leaf stage. Plants were grown under standard agronomic conditions, self-pollinated, and M2 seeds were harvested (50–300 per plant). From each M2 family, six seeds were sown, and after two weeks, 4 young leaf discs were sampled from four individuals of the family (8 mm diameter, one disc per individual) and pooled for DNA extraction by the CTAB method [25]. Uniform DNA concentrations were obtained by suspending in 200 μl water and samples were kept at -80°C. Individual family-samples of the first 768 families were arrayed in eight 96 well plates, and DNA aliquots were diluted 10 times (to obtain a 400 μl volume, ~10 ng DNA/μl) and kept at -20°C. DNA pools were prepared (8 families /pool) and arrayed in a single 96-well pooling-plate representing 768 families. Such sampling strategy was possible due to the highly sensitive TILLING screen that allows detection of mutant alleles in the eight-family x four individuals mixed sample.

Target gene amplification and screening

Amplification included two steps of nested PCR. The first involved a pair of external unlabeled primers, 22–25 nt-long, 40-50% recommended GC content, planned to generate a fragment up to 1.2 kb in size. Primers were reacted with 2 μL of the pooled genomic DNA (~20 ng) for 30 PCR cycles. The second round of PCR was performed using 1 μL of the first reaction products as template, with two pairs of internal primers present together in the same reaction. The first primer pair in the second round comprised a 3’ region that specifically binds the PCR products of the first round (having a 40-50% recommended GC content), while the 5’ region of the primer represents a universal M13 sequence “tail”, resulting in a 35 nt-long primer. The last primer pair (M13F700, 5’ CACGACGTTGTAAAACGAC and M13R800, 5’ GGATAACATTTCACACAGG) is fluorescently marked (IRDye™ 700 and IRDye™ 800) and matches the M13 sequence tags of the second primer pair. For the rms-3 and rms-4 genes, the second pair of primers was fluorescently labeled and M13-labeled primers were not required. The reaction included 35 cycles, the first 10 performed at the recommended annealing temperature of the specific primer pair, then 25 cycles at a lower annealing temperature, 50°C, required for the universal primers [3, 12]. Finally, heteroduplex molecules were formed by a temperature gradient of 94°C to 8°C (-0.1°C/sec).

The products were digested for 20 min at 45°C with EndoI endonuclease and separated on a polyacrylamide sequencing gel using a LICOR 4300 machine. The pooled 96 DNA samples were screened, and positive family-pools displaying amplicon digestion were deconvoluted to identify the positive M2 family within the pool. The family’s DNA sample (that had been prepared by mixing four individual progeny) was sequenced, to look for a mixed peak, indicating a mutation at a position predicted by the endonuclease digestion pattern. A few progeny of the family were sown and their amplicon sequenced, to confirm the mutation and correlate it with a possible phenotype. In a few cases, the mutation generated a restriction site polymorphism; in that case, genotyping was performed by restriction digestion of the PCR product, followed by agarose gel electrophoresis and ethidium bromide staining.

Abbreviations

CAPS: 

Cleaved amplified polymorphic sequence

EMS: 

Ethyl methanesulfonate

PCR: 

Polymerase chain reaction

SNP: 

Single nucleotide polymorphism

TILLING: 

Targeting Induced Local Lesions IN Genomes.

Declarations

Acknowledgements

R. Fraenkel was supported by an M.Sc. Fellowship of Bar-Ilan University. We thank Mr. David Levy for technical assistance.

Authors’ Affiliations

(1)
The Mina and Everard Goodman Faculty of Life Sciences, Bar-Ilan University
(2)
INRA-CNRS, UMR1165, Unité de Recherche en Génomique Végétale

References

  1. Comai L, Henikoff S: TILLING: practical single-nucleotide mutation discovery. Plant J. 2006, 45 (4): 684-694. 10.1111/j.1365-313X.2006.02670.x.PubMedView ArticleGoogle Scholar
  2. McCallum CM, Comai L, Greene EA, Henikoff S: Targeting induced local lesions in genomes (TILLING) for plant functional genomics. Plant Physiol. 2000, 123 (2): 439-442. 10.1104/pp.123.2.439.PubMedPubMed CentralView ArticleGoogle Scholar
  3. Colbert T, Till BJ, Tompa R, Reynolds S, Steine MN, Yeung AT, McCallum CM, Comai L, Henikoff S: High-throughput screening for induced point mutations. Plant Physiol. 2001, 126 (2): 480-484. 10.1104/pp.126.2.480.PubMedPubMed CentralView ArticleGoogle Scholar
  4. Anderson P: Mutagenesis. Methods Cell Biol. 1995, 48: 31-58.PubMedView ArticleGoogle Scholar
  5. Jones MO, Piron-Prunier F, Marcel F, Piednoir-Barbeau E, Alsadon AA, Wahb-Allah MA, Al-Doss AA, Bowler C, Bramley PM, Fraser PD, Bendahmane A: Characterisation of alleles of tomato light signalling genes generated by TILLING. Phytochemistry. 2012, 79: 78-86.PubMedView ArticleGoogle Scholar
  6. Perry J, Brachmann A, Welham T, Binder A, Charpentier M, Groth M, Haage K, Markmann K, Wang TL, Parniske M: TILLING in Lotus japonicus identified large allelic series for symbiosis genes and revealed a bias in functionally defective ethyl methanesulfonate alleles toward glycine replacements. Plant Physiol. 2009, 151 (3): 1281-1291. 10.1104/pp.109.142190.PubMedPubMed CentralView ArticleGoogle Scholar
  7. Nieto C, Piron F, Dalmais M, Marco CF, Moriones E, Gomez-Guillamon ML, Truniger V, Gomez P, Garcia-Mas J, Aranda MA, Bendahmane A: EcoTILLING for the identification of allelic variants of melon eIF4E, a factor that controls virus susceptibility. BMC Plant Biol. 2007, 7: Article Number: 34, doi:10.1186/1471-2229-7-34Google Scholar
  8. Dahmani-Mardas F, Troadec C, Boualem A, Leveque S, Alsadon AA, Aldoss AA, Dogimont C, Bendahmane A: Engineering melon plants with improved fruit shelf life using the TILLING approach. PLoS One. 2010, 5 (12): Article Number: e15776, doi:10.1371/journal.pone.0015776Google Scholar
  9. Tadmor Y, Katzir N, Meir A, Yaniv-Yaakov A, Sa’ar U, Baumkoler F, Lavee T, Lewinsohn E, Schaffer A, Burger J: Induced mutagenesis to augment the natural genetic variability of melon (Cucumis melo L.). Isr J Plant Sci. 2007, 55 (2): 159-169. 10.1560/IJPS.55.2.159.View ArticleGoogle Scholar
  10. Dalmais M, Schmidt J, Le Signor C, Moussy F, Burstin J, Savois V, Aubert G, Brunaud V, de Oliveira Y, Guichard C, Thompson R, Bendahmane A: UTILLdb, a Pisum sativum in silico forward and reverse genetics tool. Genome Biol. 2008, 9 (2): Article Number: R43, doi:10.1186/gb-2008-9-2-r43Google Scholar
  11. Triques K, Sturbois B, Gallais S, Dalmais M, Chauvin S, Clepet C, Aubourg S, Rameau C, Caboche M, Bendahmane A: Characterization of Arabidopsis thaliana mismatch specific endonucleases: application to mutation discovery by TILLING in pea. Plant J. 2007, 51 (6): 1116-1125. 10.1111/j.1365-313X.2007.03201.x.PubMedView ArticleGoogle Scholar
  12. Triques K, Piednoir E, Dalmais M, Schmidt J, Le Signor C, Sharkey M, Caboche M, Sturbois B, Bendahmane A: Mutation detection using ENDO1: application to disease diagnostics in humans and TILLING and Eco-TILLING in plants. BMC Mol Biol. 2008, 9: Article Number: 42, doi:10.1186/1471-2199-9-42Google Scholar
  13. Huang S, Li R, Zhang Z, Li L, Gu X, Fan W, Lucas WJ, Wang X, Xie B, Ni P, Ren Y, Zhu H, Li J, Lin K, Jin W, Fei Z, Li G, Staub J, Kilian A, van der Vossen EAG, Wu Y, Guo J, He J, Jia Z, Ren Y, Tian G, Lu Y, Ruan J, Qian W, Wang M: The genome of the cucumber, Cucumis sativus L. Nat Genet. 2009, 41 (12): 1275-U1229. 10.1038/ng.475.PubMedView ArticleGoogle Scholar
  14. Yang L, Koo D-H, Li Y, Zhang X, Luan F, Havey MJ, Jiang J, Weng Y: Chromosome rearrangements during domestication of cucumber as revealed by high-density genetic mapping and draft genome assembly. Plant J. 2012, 71 (6): 895-906. 10.1111/j.1365-313X.2012.05017.x.PubMedView ArticleGoogle Scholar
  15. Woycicki R, Witkowicz J, Gawronski P, Dabrowska J, Lomsadze A, Pawelkowicz M, Siedlecka E, Yagi K, Plader W, Seroczynska A, Smiech M, Gutman W, Niemirowicz-Szczytt K, Bartoszewski G, Tagashira N, Hoshi Y, Borodovsky M, Karpinski S, Malepszy S, Przybecki Z: The genome sequence of the North-European Cucumber (Cucumis sativus L.) unravels evolutionary adaptation mechanisms in plants. PLoS One. 2011, 6 (7): Article Number: e22728, doi:10.1371/journal.pone.0022728Google Scholar
  16. Greene EA, Codomo CA, Taylor NE, Henikoff JG, Till BJ, Reynolds SH, Enns LC, Burtner C, Johnson JE, Odden AR, Comai L, Henikoff S: Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in arabidopsis. Genetics. 2003, 164 (2): 731-740.PubMedPubMed CentralGoogle Scholar
  17. Downie NM, Heath RH: Basic Statistical Methods. 1983, New-York and London: Harper and Row Publishers, 5Google Scholar
  18. Qin G, Gu H, Ma L, Peng Y, Deng XW, Chen Z, Qu L-J: Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis. Cell Res. 2007, 17 (5): 471-482. 10.1038/cr.2007.40.PubMedView ArticleGoogle Scholar
  19. Trebitsh T, Staub JE, Oneill SD: Identification of a 1-aminocyclopropane-1-carboxylic acid synthase gene linked to the female (F) locus that enhances female sex expression in cucumber. Plant Physiol. 1997, 113 (3): 987-995. 10.1104/pp.113.3.987.PubMedPubMed CentralView ArticleGoogle Scholar
  20. Johnson X, Brcich T, Dun EA, Goussot M, Haurogne K, Beveridge CA, Rameau C: Branching genes are conserved across species. Genes controlling a novel signal in pea are coregulated by other long-distance signals. Plant Physiol. 2006, 142 (3): 1014-1026. 10.1104/pp.106.087676.PubMedPubMed CentralView ArticleGoogle Scholar
  21. Ng PC, Henikoff S: SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003, 31: 3812-3814. 10.1093/nar/gkg509.PubMedPubMed CentralView ArticleGoogle Scholar
  22. Caldwell DG, McCallum N, Shaw P, Muehlbauer GJ, Marshall DF, Waugh R: A structured mutant population for forward and reverse genetics in Barley (Hordeum vulgare L.). Plant J. 2004, 40 (1): 143-150. 10.1111/j.1365-313X.2004.02190.x.PubMedView ArticleGoogle Scholar
  23. Boualem A, Fleurier S, Troadec C, Audigier P, Kumar AP, Chatterjee M, Alsadon AA, Sadder MT, Wahb-Allah MA, Al-Doss AA, Bendahmane : Development of a Cucumis sativus TILLinG platform for forward and reverse genetics. PLoS One. 2014, 9 (5): e97963-10.1371/journal.pone.0097963.PubMedPubMed CentralView ArticleGoogle Scholar
  24. Markiewicz P, Kleina LG, Cruz C, Ehret S, Miller JH: Genetic-sudies of the Lac repressor.14. Analysis of 4000 altered Escherichia-coli Lac repressors reveals essential and nonessential residues, as well as spacers which do not require a specific sequence. J Mol Biol. 1994, 40 (5): 421-433.View ArticleGoogle Scholar
  25. Rogers SO, Bendich AJ: Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant-tissues. Plant Mol Biol. 1985, 5 (2): 69-76. 10.1007/BF00020088.PubMedView ArticleGoogle Scholar

Copyright

© Fraenkel et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement