Skip to main content

Gateway-compatible tissue-specific vectors for plant transformation

Abstract

Background

Understanding regulation of developmental events has increasingly required the use of tissue-specific expression of diverse genes affecting plant growth and environmental responses.

Findings

To allow for cloning of presumptive promoters with tissue-specific activities, we created two plant expression vectors with multiple cloning sites upstream of a Gateway cassette for expression of either untagged or YFP-tagged genes of interest. For fast and easy tissue-specific expression of desired genes, we further developed an initial set of Gateway-compatible tissue-specific gene expression vectors that allow for the expression of YFP-tagged or untagged proteins driven by the ALCOHOL DEHYDROGENASE1, CHLOROPHYLL A/B BINDING PROTEIN 1, COBRA LIKE1, EXPANSIN7, LATERAL ORGAN BOUNDARIES-DOMAIN 16, SCARECROW, UBIQUITIN10, and WOODEN LEG upstream regulatory regions.

Conclusions

These vectors provide an invaluable resource to the plant community, allowing for rapid generation of a variety of tissue-specific expression constructs.

Background

Multiple genes contribute to plant development, and these contributions can vary by tissue type. Increasingly, researchers are turning to tissue-specific gene expression to gain spatial resolution of these plant processes. For example, cell-type specific gene expression has allowed for dissection of the control of many processes, including ovule development [1], cell-autonomous and non-cell-autonomous controls of photoperiodic flowering [2], and the spatial specificity of phytochrome responses [3].

The currently available systems for tissue- and cell-type-specific gene expression include either cloning desired promoters individually or using two-component systems [4-9]. In some of these two-component systems consisting of a transcription factor and a target promoter, treatment with inducers such as 17-β-estradiol [6] or ethanol [4,10,11] promotes the transcription factor binding to and activating the target promoter to allow for temporal control of gene activation in addition to the spatial control afforded by tissue-specific promoters. Although these systems have been instrumental in understanding spatial and temporal gene functions, they have the disadvantage of being unwieldy when studying tissue-specific gene rescue in higher order mutants. Additionally, the alternative of cloning individual promoters can be time-consuming.

To overcome the limitations of the current systems for creating plants with tissue-specific expression of desired genes, we have developed a set of Gateway-compatible destination vectors for tissue-specific expression to facilitate spatial analysis of gene function. This novel vector set will allow for rapid, uncomplicated construct creation for spatial examination of desired genes in higher-order mutant backgrounds.

Findings

We have generated a vector set to provide a rapid method for creating transgenic plants expressing genes of interest in a tissue-specific manner. Vector details, including the complete DNA sequences, can be found on the website http://pages.wustl.edu/strader/vectors, which will be updated as additional vectors are created.

Promoterless Gateway-compatible destination vectors with multiple cloning sites for creation of plant expression constructs

We generated promoterless Gateway-compatible plant expression vectors from pEarleyGate100 [12] and pEarleyGate104 [12] by replacing the cauliflower mosaic virus 35S promoter [13] with a multiple cloning site. pEarleyGate100 [12] and pEarleyGate104 [12] were built from pFGC5941 vector (http://chromDB.org) derived from the pCAMBIA (http://www.cambia.org) vector.

We created the pMCS:GW and pMCS:YFP-GW vectors from pEarleyGate100 and pEarleyGate104 by replacing the 35S promoter regions of these starting vectors with a multiple cloning site (MCS). Because the EcoRI and XhoI sites flanking the 35S promoter are not unique in pEarleyGate100 and pEarleyGate104, we used site-directed mutagenesis to first remove the EcoRI site from the chloramphenicol resistance gene in the Gateway cassette of pEarleyGate100 and pEarleyGate104 and to remove the XhoI and EcoRI sites from the YFP gene of pEarlyGate104, while retaining the correct translation for the chloramphenicol resistance gene and YFP. We then excised the 35S promoter from the mutated versions of pEarleyGate100 and pEarleyGate104 using EcoRI and XhoI and replaced it with a MCS providing EcoRI, NruI, AatII, PmlI, and XhoI sites for cloning promoters of interest. We named these vectors pMCS:GW and pMCS:YFP-GW (Figure 1).

Figure 1
figure 1

pMCS:YFP-GW and pMCS:GW plant transformation vectors. pMCS:YFP-GW and pMCS:GW were derived from the pEarleyGate104 [12] and pEarleyGate100 [12] vectors, respectively. The pMCS:YFP-GW and pMCS:GW vectors are binary vectors for plant transformation and confer kanamycin (Km, red arrow) and chloramphenicol (in Gateway cassette) resistance in Escherichia coli and kanamycin resistance (Km, red arrow) in Agrobacterium tumefaciens. Plants transformed with these vectors will display resistance to phosphinothricin (Basta; BAR consisting of the basta resistance gene driven by the mannopine synthase promoter and flanked by the mannopine synthase 3′ end; three green arrows). The multiple cloning site (MCS) allows for cloning of desired promoters for expression of downstream genes transferred into the vector using Gateway technology. The Gateway cassette (attR1, chloramphenicol resistance gene, ccdB, attR2; pink arrow) is followed by the terminator sequence from the octopine synthase gene (OCS, blue arrow). In addition, pMCS:YFP-GW has the yellow fluorescence protein (YFP, yellow arrow) gene downstram of the MCS and in-frame with the Gateway cassette. The left border (LB) and right border (RB) of the T-DNA are marked.

The pMCS:GW vector consists of a T-DNA left border, followed by the Basta herbicide resistance gene, a multiple cloning site, the Gateway cassette (attR1, chloramphenicol resistance gene, ccdB, attR2), the 3′ sequence of the octopine synthase gene, and T-DNA right border (Figure 1). The pMCS:YFP-GW vector consists of a T-DNA left border, followed by the Basta herbicide resistance gene, a multiple cloning site, the in-frame coding region for yellow fluorescent protein (YFP), the Gateway cassette (attR1, chloramphenicol resistance gene, ccdB, attR2), the 3′ sequence of the octopine synthase gene, and T-DNA right border for creation of N-terminal YFP fusion proteins (Figure 1). pMCS:GW, pMCS:YFP-GW, and variants thereof confer kanamycin resistance to Escherichia coli and Agrobacterium tumefaciens. The T-DNA from these vectors confers phosphinothricin (Basta) resistance to plants.

Gateway-compatible destination vectors for tissue-specific expression

After creating pMCS:GW and pMCS:YFP-GW, we cloned the presumptive promoters of several genes with previously described expression patterns (Table 1) into these vectors to create a set of Gateway-compatible tissue-specific plant expression vectors. We chose this set of representative promoters to allow for diverse expression patterns, including ubiquitous expression throughout the plant body, generalized root and shoot expression, cell-type-specific expression in root and shoots, and expression in specific root tissues.

Table 1 Presumptive promoter regions used in vector set

Ubiquitous expression

UBIQUITIN10 (UBQ10) is a transcript expressed throughout the plant and is often used as a control in expression profiling experiments. Large-scale transcript profiling experiments have revealed that UBQ10 is stably expressed and is in the top percentile of highly expressed genes in Arabidopsis [14], suggesting that genes driven by the UBQ10 promoter would be highly expressed throughout the plant. To create a Gateway-compatible plant expression vector for uniform expression to serve as an alternative to 35S-driven vectors, we cloned the upstream regulatory region of UBQ10 into pMCS:GW and pMCS:YFP-GW. These new vectors, named pUBQ10:GW and pUBQ10:YFP-GW, can be used to create constructs for expressing genes encoding untagged or YFP-tagged proteins behind the UBQ10 presumptive promoter.

General shoot and root expression

We were interested in developing Gateway-compatible expression constructs for shoot and root tissues. CHLOROPHYLL A/B BINDING PROTEIN 1 (CAB1) expression is light-regulated in a phytochrome-dependent manner [15,16], induced by cold treatment [17], and regulated by circadian rhythms [18,19] and sugar homeostasis [20,21]. Additionally, CAB1 is expressed in leaf and stem tissues, but not in root tissues in peas and tobacco [22-24]. Because both near and far upstream regions of the Arabidopsis CAB1 promoter are involved in the specificity of CAB1 expression [22], we captured the region from -2148 to -1 (where +1 is the A of the CAB1 ATG) upstream of CAB1 to drive expression of our Gateway-compatible constructs. We cloned this CAB1 upstream regulatory region into pMCS:GW and pMCS:YFP-GW to create pCAB1p:GW and pCAB1p:YFP-GW.

The ALCOHOL DEHYDROGENASE1 (ADH1) promoter region has previously been used to express genes exclusively in root tissues; however, ADH1 expression in roots is not developmentally regulated. Instead, ADH1 expression is upregulated in horizontally-grown roots on agar plates because these roots are experiencing the stress of hypoxia [25,26]. Additionally, ADH1 expression is upregulated by dehydration [26,27], ABA treatment [27,28], cold [26,27], and is altered by space flight [29]. Because Dolferus et al. [26] reported the region 1 kb upstream of ADH1 was sufficient to drive GUS reporter expression to mimic the developmental and tissue-specific expression of the endogenous ADH1 gene, we cloned the ADH1 upstream regulatory region from -1092 to -1 (where +1 is the A of the ADH1 ATG) into pMCS:GW and pMCS:YFP-GW to create Gateway-compatible vectors for expression of genes in roots of horizontally-grown seedlings on agar plates. These new vectors are named pADH1:GW and pADH1:YFP-GW.

Tissue-specific expression throughout shoots and roots

SCARECROW (SCR) exhibits tissue-specific expression in both shoot and roots. SCR expression is detected in the endodermis, endodermis initials, and occasionally the quiescent center of roots [30,31]. In addition, SCR is expressed in the endodermis of seedling hypocotyls, in the L1 layer of the shoot apical meristem, and in the tissue layer adjacent to vascular bundles [32]. The 2.5-kb region upstream of SCR is sufficient to drive this expression pattern [30,32]. We cloned the SCR upstream regulatory region into pMCS:GW and pMCS:YFP-GW to create pSCR:GW and pSCR:YFP-GW.

COBRA LIKE1 (COBL1) is expressed in several tissues throughout the root, including columella, weakly in the stele, and strongly in lateral root primordia [33]. In addition, COBL1 is expressed in leaf vascular tissue and hydathodes [33]. The 687-bp region upstream of COBL1 is sufficient to drive this expression pattern [33]. We cloned the COBL1 upstream regulatory region into pMCS:GW and pMCS:YFP-GW to create pCOBL1:GW and pCOBL1:YFP-GW.

Tissue-specific expression in roots

Plant roots serve as an ideal developmental model because cells within an individual root are at various developmental stages, ordered from the root tip to the root-shoot junction. Root cells are also organized by radial symmetry, allowing for analysis along the radial axis. In addition to the Gateway-compatible tissue-specific vectors described above, which allows for expression in both root and shoot tissues, we created root tissue-specific Gateway-compatible vectors. We chose a representative set of promoters expressed in cell-type-specific manner within the roots, including EXPANSIN7, LATERAL ORGAN BOUNDARIES-DOMAIN 16, and WOODEN LEG upstream regions, and cloned them into pMCS:GW and pMCS:YFP-GW.

EXPANSIN7 (EXP7) is strictly expressed in root hair cells, and is not expressed in aerial portions of the plant [34]. The 386-bp region upstream of EXP7 was sufficient to drive this expression pattern [34]. We cloned the EXP7 upstream regulatory region into pMCS:GW and pMCS:YFP-GW to create pEXP7:GW and pEXP7:YFP-GW.

The enhancer trap line J0192 [35] has been used to drive expression of genes in lateral root primordia [36]. The insertion in J0192 is upstream of LATERAL ORGAN BOUNDARIES-DOMAIN 16 (LBD16) [35]. LBD16 is predominantly expressed in roots [37]. In young seedlings, LBD16 is expressed strongly in the primary root tip and at the root-shoot junction [35], whereas, in older seedlings, LBD16 expression is restricted to young lateral root primordia (Stages I-IV) and is no longer detected in root tips [35]. Additionally, LBD16 is weakly expressed in the root vasculature [35]. The 1.5-kb region upstream of LBD16 is sufficient to drive this expression pattern [35]. We cloned the LBD16 upstream regulatory region into pMCS:GW and pMCS:YFP-GW to create pLBD16:GW and pLBD16:YFP-GW.

WOODEN LEG/CYTOKININ RESPONSE1/ARABIDOPSIS HISTIDINE KINASE4 (WOL/CRE1/AHK4) is expressed in the vascular cylinder and pericycle of root tissues [38,39]. We cloned the WOL upstream regulatory region into pMCS:GW and pMCS:YFP-GW to create pWOL:GW and pWOL:YFP-GW.

These tissue-speficic-promoter-driven Gateway-compatible constructs allow for easy insertion of genes of interest and can be used to drive expression of genes of interest in various root and shoot tissues.

Evaluation of tissue-specific expression

To determine whether our Gateway-compatible tissue-specific expression constructs expressed in the predicted (see Table 1) tissues, we transformed each of them into the Col-0 background. We found that the Gateway cassette, present in each of these constructs and carrying the ccdB “death” gene, had no obvious effects on plant growth and development. pUBQ10:YFP-GW expression was detected throughout the plant (Figure 2A) whereas pCAB1:YFP-GW expression was detected only in the shoot (Figure 2B). We found that, as expected [25,26], we could detect YFP signal only in roots of horizontally-grown seedlings expressing pADH1:YFP-GW (Figure 2C). We further detected signal from pWOL:YFP-GW in the vascular bundle and pericycle (Figure 2D). We detected signal from pEXP7:YFP-GW in root trichoblast cells (Figure. 2E). The YFP signal was detected in lateral root primordia of seedlings transformed with the pCOBL1:YFP-GW (Figure 2F) and pLBD16:YFP-GW (Figure 2G) constructs. Seedlings transformed with pSCR:YFP-GW displayed fluorescence in the root endodermis (Figure 2H).

Figure 2
figure 2

Tissue-specificity of pUBQ10:YFP-GW, pCAB1:YFP-GW, pADH1:YFP-GW, pWOL:YFP-GW, pSCR:YFP-GW, pEXP7:YFP-GW, pCOBL1:YFP-GW, and pLBD16:YFP-GW. (A) YFP signal is detected in all examined tissues of seedlings carrying the pUBQ10:YFP-GW vector by epi-fluorescence microscopy. Epi-fluorescence microscopy reveals shoot and root YFP signal in seedlings carrying (B) pCAB1:YFP-GW and (C) pADH1:YFP-GW, respectively. (D) YFP signal is detected in the vascular bundle and pericycle of seedlings carrying the pWOL:YFP-GW vector by epi-fluorescence microscopy. Confocal microscopy reveals YFP signal in (E) root endodermis of seedlings carrying the pSCR:YFP-GW vector, (F) root hairs of seedlings carrying pExp7:YFP-GW, (G) lateral root primordia of seedlings carrying pCOBL1:YFP-GW, and (H) lateral root primordia of seedlings carrying pLBD16:YFP-GW.

Our observed expression patterns from all tested constructs matched expected expression patterns (Table 1), suggesting that these Gateway-compatible vectors will allow spatial examination of the effects of genes of interest.

Conclusion

In summary, we have generated two plant expression vectors with multiple cloning sites upstream of a Gateway cassette for expression of either untagged or YFP-tagged genes of interest. We have further developed an initial set of ten Gateway-compatible tissue-specific gene expression vectors that allow for the expression of YFP-tagged or untagged proteins driven by the ALCOHOL DEHYDROGENASE1, CHLOROPHYLL A/B BINDING PROTEIN 1, COBRA LIKE1, EXPANSIN7, LATERAL ORGAN BOUNDARIES-DOMAIN 16, SCARECROW, UBIQUITIN10, and WOODEN LEG presumptive promoters. These vectors provide an invaluable resource to the plant community to allow for rapid generation of tissue-specific plant expression constructs.

Although our observed expression patterns (Figure 2) matched our expected expression patterns (Table 1), the tissues in which these constructs are expressed may be affected by growth conditions and mutant background. For example, the ADH1 promoter, which responds to anoxia for root expression [25,26] is also responsive to dehydration [26,27], ABA treatment [27,28], cold [26,27], and space flight [29]. Thus, caution and appropriate controls should be used when interpreting data.

We anticipate that additional tissue-specific Gateway-compatible vectors based on the MCS:GW and MCS:YFP-GW vectors will be created by our lab and by other labs. We will maintain a database of further constructs created from the MCS:GW and MCS:YFP-GW backbones at http://pages.wustl.edu/strader/vectors.

In summary, we have engineered a set of Gateway-compatible vectors for tissue-specific expression to provide a reliable cloning method for quick creation of expression constructs for multiple tissues. We anticipate that these vectors will be a useful addition to the many Gateway-compatible vectors currently available to the plant community.

Materials and methods

Vector construction

pMCS:GW and pMCS:YFP-GW vectors

To remove the EcoRI site from the chloramphenicol resistance gene region of pEarleyGate100 [12] and pEarlyGate104 [12], we performed site-directed mutagenesis using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) and primers CM-M1 (5′ – CATCCGGAGTTCCGTATGGCAATGAAAGACGGTGAGCTG – 3′) and CM-M2 (5′ – CAGCTCACCGTCTTTCATTGCCATACGGAACTCCGGATG – 3′). To remove the XhoI and EcoRI sites from the YFP region of pEarlyGate104 [12], we performed site-directed mutagenesis using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) and primers YFP-M1 (5′-GACTCAGATCACGAGCTCAAGCTTCAAATTCTGCAGTCGACGGTA-3′) and YFP-M2 (5′-TACCGTCGACTGCAGAATTTGAAGCTTGAGCTCGTGATCTGAGTC-3′). To create a double-stranded multiple cloning site (MCS), we annealed MCS-1 (5′-AATTCGCGACGTCCCTAGGAGATCTTCGAACACGTGAGGCC-3′) and MCS-2 (5′-TCGAGGCCTCACGTGTTCGAAGATCTCCTAGGGACGTCGCG-3′) by heating 100 pmol of each oligonucleotide in 2x SSC to 100°C for 5 minutes before cooling to room temperature on the bench top. This annealed double-stranded MCS had overhangs compatible with EcoRI and XhoI restriction sites. The mutant pEarleyGate100 and pEarlyGate104 vectors were digested with EcoRI and XhoI to excise the 35S promoter. The double-stranded MCS was cloned into the mutant pEarleyGate100 and pEarlyGate104 backbones to create pMCS:GW (derived from pEarleyGate100) and pMCS:YFP-GW (derived from pEarleyGate104).

Cloning upstream regulatory regions

Genomic DNA was extracted from Arabidopsis thaliana Columbia-0 (Col-0) seedling tissue [40]. Upstream regulatory regions for use in tissue-specific expression vectors were PCR-amplified from Col-0 genomic DNA using Pfx Platinum Taq (Life Technologies) and the following primer pairs: ADH1-EcoRI (5′-GAATTCCACACTGAAGAAAAAGATTACACC-3′) and ADH1-XhoI (5′-CTCGAGCAACAGTGAAGAACTTGCTTTTG-3′); CAB1-NruI (5′-TCGCGAGACTAACTTGTGAGTGAGAGTG-3′) and CAB1-XhoI (5′-CTCGAGGAGGTTGAGTAGTGCAGCAC-3′); COBL1-NruI (5′-TCGCGACTCATGTTTGGTTGTACTACTG-3′) and COBL1-XhoI (5′-CTCGAGCTGAAGCAAAAAAAGAGAGAG-3′); EXP7-EcoRI (5′-GAATTCCGTCAAGGCTGGATATGCTGTG-3′) and EXP7-XhoI (5′-CTCGAGGCTGCGATCTAACAATTTCAGAC-3′); LBD1-EcoRI (5′-GAATTCGCGGAAGAACTTATAAAATAAC-3′) and LBD1-XhoI (5′-CTCGAGCGGCGAAACGAACAAAAAAGTG-3′); SCR-EcoRI (5′-GAATTCGATTGTGATCCTCTGCAACAAAGC-3′) and SCR-XhoI (5′-CTCGAGGGAGATTGAAGGGTTGTTGGTCG-3′); UBQ10-AatII (5′-GACGTCGTATGATCGCGAAGCACCCACCCTAAGC-3′) and UBQ10-XhoI (5′-CTCGAGGACAAATTCGATCGCACAAAC-3′); and WOL1-AatII (5′-GACGTCCTCACACACCACACCATCATTATC-3′) and WOL1-XhoI (5′-CTCGAGCACTTCAAATGTAGGTATTCC-3′). The resulting PCR products were captured into the pCR4 vector (Life Technologies) to create pCR4-ADH1p, pCR4-CAB1p, pCR4-COBL1p, pCR4-EXP7p, pCR4-LBD16p, pCR4-SCRp, pCR4-UBQ10p, and pCR4-WOL1p. All constructs were sequenced (GeneWiz, Inc.) to confirm error-free clones.

Gateway-compatible tissue-specific expression vectors

The ADH1 upstream regulatory region was excised from pCR4-ADH1p using EcoRI and XhoI and subcloned into pMCS:GW and pMCS:YFP-GW to create pADH1:GW and pADH1:YFP-GW. The CAB1 upstream regulatory region was excised from pCR4-CAB1p using NruI and XhoI and subcloned into pMCS:GW and pMCS:YFP-GW to create pCAB1:GW and pCAB1:YFP-GW. The COBL1 upstream regulatory region was excised from pCR4-COBL1p using NruI and XhoI and subcloned into pMCS:GW and pMCS:YFP-GW to create pCOBL1:GW and pCOBL1:YFP-GW. The EXP7 upstream regulatory region was excised from pCR4-EXP7p using EcoRI and XhoI and subcloned into pMCS:GW and pMCS:YFP-GW to create pEXP7:GW and pEXP7:YFP-GW. The LBD16 upstream regulatory region was excised from pCR4-LBD16p using EcoRI and XhoI and subcloned into pMCS:GW and pMCS:YFP-GW to create pLBD16:GW and pLBD16:YFP-GW. The SCR upstream regulatory region was excised from pCR4-SCRp using EcoRI and XhoI and subcloned into pMCS:GW and pMCS:YFP-GW to create pSCR:GW and pSCR:YFP-GW. The UBQ10 upstream regulatory region was excised from pCR4-UBQ10p using AatII and XhoI and subcloned into pMCS:GW and pMCS:YFP-GW to create pUBQ10:GW and pUBQ10:YFP-GW. The WOL1 upstream regulatory region was excised from pCR4-WOL1p using AatII and XhoI and subcloned into pMCS:GW and pMCS:YFP-GW to create pWOL1:GW and pWOL1:YFP-GW. All constructs were sequenced (GeneWiz, Inc.) to confirm error-free clones.

Plant transformation and plant growth conditions

The pADH1:YFP-GW, pCAB1:YFP-GW, pCOBL1:YFP-GW, pEXP7:YFP-GW, pLBD16:YFP-GW, pSCR:YFP-GW, pUBQ10:YFP-GW, and pWOL:YFP-GW plasmids were electroporated into Agrobacterium tumefaciens strain GV3101 [41]. Arabidopsis thaliana Col-0 was transformed by the floral dip method [42]. Transformants were selected on plant nutrient (PN) medium [43] solidified with 0.6% (w/v) agar and supplemented with 7.5 μg/mL Basta (phosphinothricin).

Microscopy

Seedlings were mounted and imaged using either a Leica MZ10F fluorescence stereomicroscope with a YFP filter set (510/20 nm excitation, 560/40 nm emission) or with a Zeiss LSM510 laser scanning microscope. Images were converted and merged using NIH Image software.

Distribution of materials

All described plant expression vectors are deposited at the Arabidopsis Biological Resource Center (ABRC; www.arabidopsis.org). ABRC stock numbers, vector maps, and sequences can be found at http://pages.wustl.edu/strader/vectors.

References

  1. Groß-Hardt R, Lenhard M, Laux T. WUSCHEL signaling functions in interregional communication during Arabidopsis ovule development. Genes Dev. 2002;16:1129–38.

    Article  PubMed Central  PubMed  Google Scholar 

  2. An H, Roussot C, Suárez-López P, Corbesier L, Vincent C, Piñeiro M, et al. CONSTANS acts in the phloem to regulate a systemic signal that induces photoperiodic flowering of Arabidopsis. Development. 2004;131:3615–26.

    Article  CAS  PubMed  Google Scholar 

  3. Warnasooriya SN, Montgomery BL. Detection of spatial-specific phytochrome responses using targeted expression of biliverdin reductase in Arabidopsis. Plant Physiol. 2009;149:424–33.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  4. Jia H, Van Loock B, Liao M, Verbelen JP, Vissenberg K. Combination of the ALCR/alcA ethanol switch and GAL4/VP16-UAS enhancer trap system enables spatial and temporal control of transgene expression in Arabidopsis. Plant Biotechnol J. 2007;5:477–82.

    Article  CAS  PubMed  Google Scholar 

  5. Baroux C, Blanvillain R, Betts H, Batoko H, Craft J, Martinez A, et al. Predictable activation of tissue-specific expression from a single gene locus using the pOp/LhG4 transactivation system in Arabidopsis. Plant Biotechnol J. 2005;3:91–101.

    Article  CAS  PubMed  Google Scholar 

  6. Brand L, Hörler M, Nüesch E, Vassalli S, Barrell P, Yang W, et al. A versatile and reliable two-component system for tissue-specific gene induction in Arabidopsis. Plant Physiol. 2006;141:1194–204.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  7. Engineer CB, Fitzsimmons KC, Schmuke JJ, Dotson SB, Kranz RG. Development and evaluation of a Gal4-mediated LUC/GFP/GUS enhancer trap system in Arabidopsis. BMC Plant Biol. 2005;5:9.

    Article  PubMed Central  PubMed  Google Scholar 

  8. Wu C, Li X, Yuan W, Chen G, Kilian A, Li J, et al. Development of enhancer trap lines for functional analysis of the rice genome. Plant J. 2003;35:418–27.

    Article  CAS  PubMed  Google Scholar 

  9. Haseloff J. GFP variants for multispectral imaging of living cells. Methods Cell Biol. 1999;58:139–51.

    Article  CAS  PubMed  Google Scholar 

  10. Maizel A, Weigel D. Temporally and spatially controlled induction of gene expression in Arabidopsis thaliana. Plant J. 2004;38:164–71.

    Article  CAS  PubMed  Google Scholar 

  11. Deveaux Y, Peaucelle A, Roberts GR, Coen E, Simon R, Mizukami Y, et al. The ethanol switch: a tool for tissue-specific gene induction during plant development. Plant J. 2003;36:918–30.

    Article  CAS  PubMed  Google Scholar 

  12. Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, et al. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J. 2006;45(4):616–29.

    Article  CAS  PubMed  Google Scholar 

  13. Odell JT, Nagy F, Chua NH. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature. 1985;313:810–2.

    Article  CAS  PubMed  Google Scholar 

  14. Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 2005;139:5–17.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  15. Karlin-Neumann GA, Sun L, Tobin EM. Expression of light-harvesting chlorophyll a/b-protein genes is phytochrome-regulated in etiolated Arabidopsis thaliana seedlings. Plant Physiol. 1988;88:1323–31.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  16. Gao J, Kaufman LS. Blue-Light Regulation of the Arabidopsis thaliana Cab1 Gene. Plant Physiol. 1994;104:1251–7.

    PubMed Central  CAS  PubMed  Google Scholar 

  17. Capel J, Jarillo JA, Madueño F, Jorquera MJ, Martinez-Zapater JM, Salinas J. Low temperature regulates Arabidopsis Lhcb gene expression in a light-independent manner. Plant J. 1998;13:411–8.

    Article  CAS  PubMed  Google Scholar 

  18. Nagy F, Kay SA, Chua NH. A circadian clock regulates transcription of the wheat Cab-1 gene. Genes Dev. 1988;2:376–82.

    Article  CAS  Google Scholar 

  19. Millar AJ, Kay SA. Circadian control of cab gene transcription and mRNA accumulation in Arabidopsis. Plant Cell. 1991;3:541–50.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  20. Wingenter K, Schulz A, Wormit A, Wic S, Trentmann O, Hoermiller II, et al. Increased activity of the vacuolar monosaccharide transporter TMT1 alters cellular sugar partitioning, sugar signaling, and seed yield in Arabidopsis. Plant Physiol. 2010;154:665–77.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  21. Koch KE. Carbohydrate-modulated gene expression in plants. Annu Rev Plant Physiol Plant Mol Biol. 1996;47:509–40.

    Article  CAS  PubMed  Google Scholar 

  22. Ha SB, An G. Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis thaliana cab1 gene. Proc Natl Acad Sci U S A. 1988;85:8017–21.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  23. Simpson J, VANM M, Herrera Estrella L. Photosynthesis-associated gene families: differences in response to tissue-specific and environmental factors. Science. 1986;233:34–8.

    Article  CAS  PubMed  Google Scholar 

  24. Simpson J, Schell J, Van Montagu M, Herrera-Estrella L. Light-inducible and tissue-specific pea lhcp gene expression involves an upstream element combining enhancer- and silencer-like properties. Nature. 1986;323:551–4.

    Article  CAS  Google Scholar 

  25. Chung HJ, Ferl RJ. Arabidopsis alcohol dehydrogenase expression in both shoots and roots is conditioned by root growth environment. Plant Physiol. 1999;121:429–36.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  26. Dolferus R, Jacobs M, Peacock WJ, Dennis ES. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene. Plant Physiol. 1994;105:1075–87.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  27. Hoeren FU, Dolferus R, Wu Y, Peacock WJ, Dennis ES. Evidence for a role for AtMYB2 in the induction of the Arabidopsis alcohol dehydrogenase gene (ADH1) by low oxygen. Genetics. 1998;149:479–90.

    PubMed Central  CAS  PubMed  Google Scholar 

  28. de Bruxelles GL, Peacock WJ, Dennis ES, Dolferus R. Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol. 1996;111:381–91.

    Article  PubMed Central  PubMed  Google Scholar 

  29. Paul AL, Daugherty CJ, Bihn EA, Chapman DK, Norwood KL, Ferl RJ. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis. Plant Physiol. 2001;126:613–21.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  30. Malamy JE, Benfey PN. Analysis of SCARECROW expression using a rapid system for assessing transgene expression in Arabidopsis roots. Plant J. 1997;12:957–63.

    Article  CAS  PubMed  Google Scholar 

  31. Di Laurenzio L, Wysocka-Diller J, Malamy JE, Pysh L, Helariutta Y, Freshour G, et al. The SCARECROW gene regulates an asymmetric cell division that is essential for generating the radial organization of the Arabidopsis root. Cell. 1996;86:423–33.

    Article  PubMed  Google Scholar 

  32. Wysocka-Diller JW, Helariutta Y, Fukaki H, Malamy JE, Benfey PN. Molecular analysis of SCARECROW function reveals a radial patterning mechanism common to root and shoot. Development. 2000;127(3):595–603.

    CAS  PubMed  Google Scholar 

  33. Brady SM, Song S, Dhugga KS, Rafalski JA, Benfey PN. Combining expression and comparative evolutionary analysis. COBRA Gene Fam Plant Physiol. 2007;143(1):172–87.

    Article  CAS  Google Scholar 

  34. Cho HT, Cosgrove DJ. Regulation of root hair initiation and expansin gene expression in Arabidopsis. Plant Cell. 2002;14(12):3237–53.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  35. Laplaze L, Parizot B, Baker A, Ricaud L, Martinière A, Auguy F, et al. GAL4-GFP enhancer trap lines for genetic manipulation of lateral root development in Arabidopsis thaliana. J Exp Bot. 2005;56:2433–42.

    Article  CAS  PubMed  Google Scholar 

  36. Laplaze L, Benkova E, Casimiro I, Maes L, Vanneste S, Swarup R, et al. Cytokinins act directly on lateral root founder cells to inhibit root initiation. Plant Cell. 2007;19:3889–900.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  37. Shuai B, Reynaga-Pena CG, Springer PS. The lateral organ boundaries gene defines a novel, plant-specific gene family. Plant Physiol. 2002;129:747–61.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  38. Mähönen AP, Bonke M, Kauppinen L, Riikonen M, Benfey PN, Helariutta Y. A novel two-component hybrid molecule regulates vascular morphogenesis of the Arabidopsis root. Genes Dev. 2000;14(23):2938–43.

    Article  PubMed Central  PubMed  Google Scholar 

  39. Bonke M, Thitamadee S, Mähöonen AP, Hauser MT, Helariutta Y. APL regulates vascular tissue identity in Arabidopsis. Nature. 2003;426:181–6.

    Article  CAS  PubMed  Google Scholar 

  40. Thole JM, Beisner ER, Liu J, Venkova SV, Strader LC. Abscisic acid regulates root elongation through the activities of auxin and ethylene in Arabidopsis thaliana. G3 (Bethesda). 2014, in press.

  41. Koncz C, Schell J. The promoter of the TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol Gen Genet. 1986;204:383–96.

    Article  CAS  Google Scholar 

  42. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16:735–43.

    Article  CAS  PubMed  Google Scholar 

  43. Haughn GW, Somerville C. Sulfonylurea-resistant mutants of Arabidopsis thaliana. Mol Gen Genet. 1986;204:430–4.

    Article  CAS  Google Scholar 

Download references

Acknowledgments

We are grateful to the ABRC for providing the pEarleyGate100 and pEarleyGate104 vectors and Tara Enders, David Korasick, and Samantha Powers for critical comments on the manuscript. This research was supported by the National Institutes of Health (R00 GM089987-03 to L.C.S.).

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Lucia C Strader.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

MM, EF, and LS: conceptualized experiments and created vectors and manuscript writing. MM: collected microscopy images. All authors read and approved the final manuscript.

Rights and permissions

Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.

The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.

The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Michniewicz, M., Frick, E.M. & Strader, L.C. Gateway-compatible tissue-specific vectors for plant transformation. BMC Res Notes 8, 63 (2015). https://doi.org/10.1186/s13104-015-1010-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13104-015-1010-6

Keywords