Skip to content

Advertisement

  • Research Note
  • Open Access

Multiplex PCR for the simultaneous detection of the Enterobacterial gene wecA, the Shiga Toxin genes (stx1 and stx2) and the Intimin gene (eae)

BMC Research Notes201811:360

https://doi.org/10.1186/s13104-018-3457-8

©  The Author(s) 2018

  • Received: 19 March 2018
  • Accepted: 31 May 2018
  • Published:

Abstract

Objectives

The aetiology of several human diarrhoeas has been increasingly associated with the presence of virulence factors rather than with the bacterial species hosting the virulence genes, exemplified by the sporadic emergence of new bacterial hosts. Two important virulence factors are the Shiga toxin (Stx) and the E. coli outer membrane protein (Eae) or intimin, encoded by the stx and eae genes, respectively. Although several polymerase chain reaction (PCR) protocols target these virulence genes, few aim at detecting all variants or have an internal amplification control (IAC) included in a multiplex assay. The objective of this work was to develop a simple multiplex PCR assay in order to detect all stx and eae variants, as well as to detect bacteria belonging to the Enterobacteriaceae, also used as an IAC.

Results

The wecA gene coding for the production of the Enterobacterial Common Antigen was used to develop an Enterobacteriaceae specific qPCR. Universal primers for the detection of stx and eae were developed and linked to a wecA primer pair in a robust triplex PCR. In addition, subtyping of the stx genes was achieved by subjecting the PCR products to restriction digestion and semi-nested duplex PCR, providing a simple screening assay for human diarrhoea diagnostic.

Keywords

  • eae
  • Enterobacteriaceae
  • Enterobacterial Common Antigen (ECA)
  • Multiplex PCR
  • stx
  • Diagnostic
  • Faecal indicator bacteria (FIB)
  • Indicator organisms

Introduction

According to WHO diarrhoeal disease is the second cause of death of children less than 5 years old, killing around half a million every year [1]. Hence, easy to implement diagnostic tests are highly relevant for patient care as well as for food and water monitoring. Once associated only with specific bacterial strains or serotypes, some diseases have been caused by new strains that were not previously identified as food/water-borne pathogens. A major mechanism associated with the emergence of pathogens is horizontal gene transfer enabling the sudden acquisition of virulence factors [2, 3] also between phylogenetically distant bacterial genera [4]. Among the numerous known virulence genes, stx and eae play a major role in the virulence of various enteric pathogens members of the Enterobacteriaceae [5–7]. Detecting the presence of these virulence genes is now a common procedure for tracking the associated aetiologic agents although other markers have also recently been used to monitor diarrhoeic E. coli [8]. The Shiga toxin producing E. coli (STEC) comprises the enterohaemorrhagic E. coli (EHEC) pathotype and is defined by the presence of the stx gene. Two main types of this virulence factor have been defined, stx1 (quasi identical to Stx produced by Shigella dysenteriae) and stx2, both of which are further divided in several subtypes [9]. Most STEC detection methods rely on the identification of serotype O157H7. As more than 50% of STEC infections may be caused by non-O157H7 strains, the need for diagnostic methods detecting all types of STEC has been emphasized [10, 11]. The gene eae coding for intimin has been found in enteropathogenic E. coli (EPEC), EHEC, E. albertii and Citrobacter rodentium [12].

Several multiplex polymerase chain reaction (PCR) methods for the detection of virulence factors and serogroup markers associated with human gastrointestinal diseases have been previously developed which include the presence of an internal amplification control (IAC) [13–16], or of an indicator organism such as E. coli to provide a positive control [17–21] (see Additional file 1). E. coli belongs to the Enterobacteriaceae, a group which includes the total coliforms (TC) and most enteric pathogens and is described as a “general (process) microbial indicator” [22] used for assessing the efficiency of food and water treatment. Therefore, in the present method, the Enterobacteriaceae was chosen to serve both as a general microbial indicator of sample contamination, and as a positive control for the multiplex PCR when tracking the presence of stx and eae genes. The “universal” primer design for the detection of stx and eae virulence genetic elements aims at detecting all variants of the gene regardless of the bacterial host species whereas other “universal” stx and eae primers, aim at E. coli (Additional file 1). In addition, sequence variability within the stx PCR product was exploited in order to develop a nested PCR and a restriction digestion protocol for typing of the genes. To our knowledge it is the first time such screening “universal” stx and eae primers are used in a multiplex PCR with an Enterobacteriaceae IAC.

Main Text

Materials and methods

Bacterial strains and culture media

For testing the multiplex protocol, the 23 bacterial isolates used are listed in Additional file 2. The bacterial strains were provided by The Norwegian National Institute for Health (Folkehelsa) and the Rikshospitalet University Hospital. Pure cultures were grown in 10 ml Luria Broth over night at 37 °C with shaking. Grown cultures were boiled for 10 min, and serially diluted in water before being used for PCR analysis. Alternatively, single colonies were picked from agar plates, suspended in water and used directly for the PCR.

Software and primers

Sequence alignments were performed using the Multalin web site http://multalin.toulouse.inra.fr/multalin/ accessed 1 February 2018 [23]. Primer design as well as restriction enzyme analyses were performed with Oligo 6.0 (Molecular Biology Insights, Inc., USA) software or performed manually using the alignments results and guidelines [24–27]. Amplicon product sizes and primer sequence are shown in Table 1.
Table 1

Primer sequences, product sizes and conditions used in the triplex and simplex PCRs

Primer sets

Target genes

Primers

MgCl2 (mM)

Product size (bp)

Names

Sequences (5′–3′)a

μM

A

wecA

Meca202U

GGGTTGTCCTGCGTCTCGTT

0.05

3

452

Meca633L

TATTCTGCCAGCACGCCAATG

stx1 and stx2

UstxU1

TRTTGARCRAAATAATTTATATGT

0.5

526 (stx1)

UstxL1

MTGATGATGRCAATTCAGTAT

523 (stx2)

stxA 2f

UstxU3

AATGGAACGGAATAACTTATATGT

0.05

523

UstxL3

GGTTGAGTGGCAATTAAGGAT

eae intimin

Ueae28U

ACCCGGCACAAGCATAAG

0.1

741

Ueae748L

CGTAAAGCGRGAGTCAATRTA

B

stx1 and stx2

UstxL1

MTGATGATGRCAATTCAGTAT

0.1

3

 

stx 1

Nestx1

GTACAACACTKGATGATCTC

0.3

200

stx 2

Nestx2

TGACRACGGACAGCAGT

0.05

410

C

wecA

Meca480UU21

GGATATGGTGGCGATTATGTA

0.2

2

226

Meca685LU21

GAATGCTAGCAAAAAGAGCAC

Meca479UU21

TGGATATGGTGGCGATTATGT

0.2

2

261

Meca722LU18

TCCAGGCMCGCTTAATGC

Triplex PCR (A) semi-nested duplex PCR for stx1 and stx2 typing (B) and simplex PCR for Enterobacteriaceae (C)

aR = A or G, M = A or C, K = G or T

PCR amplification

Samples (10 μl) were amplified in 50 μl final reaction mixtures using a BioTest Biometra or a TGRADIENT (Whatman-BiometraR) PCR thermocycler. For the semi-nested duplex PCR, a 1000-fold dilution of the triplex reaction was used. The buffered (1×) mixtures contained 0.1 mM nucleotides and 0.2 U of DyNazyme II (Finnzymes) DNA polymerase. The concentration of primers and MgCl2 for the triplex PCR and the semi-nested duplex PCR were as indicated in Table 1. For the simplex stx PCR, 0.1 μM of primers UstxU1 and UstxL1 and 0.01 μM UstxU3 and UstxL3 were used. Thermocycling conditions were as follows: 2 min preheating at 94 °C followed by 40 (triplex and simplex), or 25 (semi-nested duplex PCR) cycles of 94 °C for 15 s, 57 °C for 30 s and 72 °C for 60 s. PCR products were separated by electrophoresis on a 1.7% 0.5 × Tris–borate–EDTA agarose gel stained with ethidium bromide, visualized using 75 V and 25 mA for 1 h 30 min and then photographed under UV illumination.

Restriction endonuclease

The reaction mixture contained 16 μl PCR products, 10 U BsrI restriction endonuclease (New England Biolab) with the provided NEB3 buffer in a total volume of 20 μl. Digestion was performed in PCR tubes at 65 °C for 2 h 30 min in the thermocycler after which 10 μl of the sample was analysed by electrophoresis as described for PCR amplification.

Results

Virulence factors

A total of 45 different stxA gene sequences and 21 different eaeA gene sequences were aligned (see A1 and A2, respectively in [28]). The primers were aimed at detecting all variants of stx and eae, and thus were designed on the basis of the most conserved area of the DNA sequence alignment. An alignment of the universal degenerate Ustx primers with the most relevant primer pairs used in other PCR protocols is shown in Additional file 3.

Triplex PCR

The triplex PCR was developed to simultaneously detect Enterobacteriaceae, used as an IAC, and the presence or absence of any variants of stx and eae genes. The triplex PCR was optimized varying annealing temperature, primer concentration and by testing additives or facilitators such as DMSO, glycerol, bovine serum albumin, formamide and MgCl2 which are reported to improve multiplex PCR [24, 29, 30]. Only increasing the concentration of MgCl2 from 2 to 3 mM improved results as shown in Fig. 1. The results from testing 19 pathogenic E. coli, 3 S. dysenteriae and 1 non-pathogenic E. coli, for specificity of the assay are shown in Fig. 2a and Additional file 2.
Fig. 1
Fig. 1

Triplex PCR optimization for MgCl2 concentration. Lanes 2–4 2 mM MgCl2, Lanes 5–7 3 mM MgCl2, Lanes 8–10 4 mM MgCl2, Lane 1 DNA size ladder, Lanes 2, 5 and 8 E. coli O157:H7, Lanes 3, 6 and 9 E. coli O157:H7 and S. dysenteriae, Lanes 4, 7 and 10 S. dysenteriae, Lane 11 negative control

Fig. 2
Fig. 2

Multiplex PCR products gel electrophoresis results. a Triplex PCR performed on 23 bacterial strains of E. coli and S. dysenteriae showing the amplicon products for eae, stx and wecA genes. Lane A DNA size ladder, Lanes 1–23 bacteria as listed in Additional file 2, Lane B negative control. b Semi-nested duplex PCR using as template the stx universal PCR amplicon (526–523 bp). Lane A DNA size ladder, Lanes 1–14 stx positive strains as listed in Additional file 2 and shown in a Lanes 1–14, Lane B negative control

Semi-nested duplex PCR for differentiating stx 1 and stx 2

The semi-nested duplex PCR consisted of UstxL1, used as the reverse primer in the triplex PCR, and two new forward primers, Nestx1 and Nestx2. These two forward primers are complementary to stx1 and stx2 respectively and are located within the amplicon produced in the triplex. The products of the amplification consist of 200 bp and 410 bp for stx1 and stx2, respectively. The assay was tested on 14 strains containing stx1 or stx2, or both, and the results are shown in Fig. 2b. These results were corroborated by those produced by the restriction enzymatic digestion assay shown in Additional files 4 and 5.

Enzymatic restriction digestion for typing

The result obtained after digestion with BsrI of the stx simplex PCR product is shown in Additional file 4. The fragment pattern enables the distinction of four different groups of stx variants, stx1c, stx1, stx2 + stx2c + stx2d, and stx2e + stx2f as shown in Additional file 5. The smallest fragment, of 39 bp, could not be visualised on the agarose gel, but this does not affect the interpretation of the results. Similarly, the 62 bp fragment produced from stx1 was not always visible. However, this fragment was not required for positive identification of stx1, which was specifically identified by the presence of the 334 bp fragment.

Discussion

Enterobacterial Common Antigen

The Enterobacterial Common Antigen (ECA) was first described in 1963 by Kunin [31] and is defined as a cross-reactive antigen that is detectable in all genera of Enterobacteriaceae by several methods including using antisera to E. coli [32]. ECA was later found to be strictly family specific with diagnostic potential because of its universal presence in the family (see reviews [32]). Two of the genes implicated in the ECA synthesis are the rfe and rff genes [33, 34] later renamed wec [35]. Immunology-based diagnostic tests have been developed to detect the presence of ECA for clinical applications [36] and later to monitor the quality of drinking water by probing for bacteria belonging to the Enterobacteriaceae family [37]. In the PCR based protocols used here, the wecA primers detected all tested 23 strains of E. coli and S. dysenteriae.

Virulence genes

Eighteen varieties of intimin have been described [38] among which: α (alpha), β (beta), γ (gamma), δ (delta) [39] and ε (epsilon) [40]. The eae gene is found in the locus of enterocyte effacement (LEE) pathogenicity island of both EPEC and EHEC [41, 42]. In the present study, all 6 tested EPEC were eae-positive as well as 11 EHEC out of 13 tested. Of the two negatives, EHEC O113:H21 has also been reported eae-negative in a previous study [43].

Among the two stx groups, the second, stx2 and its five variants, is the most diverse and includes the most potent Shiga toxins for humans. Both stx2 and stx2c are mainly hosted by STEC associated with the aetiology of severe human diarrhoea whereas stx2d has been isolated in STEC from human as well as cattle origin [44]. Finally, stx2e is found in porcine STEC [45] while stx2f is found in STEC hosted by birds [46, 47]. Although the toxins Stx2e and Stx2f seem to be adapted to their respective hosts, both have been associated with human disease [45, 48]. Swine was also shown to harbour STEC carrying stx1 and stx2d associated with human infections [49], a finding which further underlines the importance of establishing screening methods designed for detecting all variants. The results obtained for stx in the present study were in agreement with expectations. All three S. dysenteriae were positive for stx by triplex PCR and further confirmed to harbour stx1 by both semi-nested duplex PCR and enzymatic restriction. Among the 13 EHEC strains, 11 were found stx positive by triplex PCR. Strain ATCC 43888 was stx-negative as expected whereas strain 3005/00 was unexpectedly stx-negative although eae-positive. This could be the result of loss of the virulence factor as it has been previously demonstrated for stx both in vivo [50] and in vitro [51].

Three EHEC strains were shown to have both stx1 and stx2, confirmed by both the semi-nested duplex PCR and the enzymatic restriction typing method. In particular, strain BE97-2317 was shown by enzymatic restriction to harbour stx1c, a gene coding for a toxin type also previously found associated with EHEC O128:H2 and negative for eae [43].

Various universal primer pairs for the detection of stx have been described in [52–59] some which overlap with the Ustx primers employed in this study (Additional file 3). However, few primers are able to detect all variants and are used in a multiplex assay [60–62] or also have integrated an IAC such as E. coli detection [19]. Integrating the detection of an indicator group, expected to be co-detected along with the targeted virulence markers, has the advantages over using a traditional IAC that it will also be able to detect, not only PCR inhibition or failure, but also absence of DNA. Finally, the Enterobacteriaceae family has been described as a possible alternative to faecal indicator bacteria, as it can better reflect the hygienic status of food products [63], hence Enterobacteriaceae PCR assays should find several areas of applications. Overall, this simple molecular screening assay including its further typing possibility for stx, should help food and health authorities to increase their monitoring efforts to improve water and food microbiological quality as well as patient diagnostic capabilities.

Limitations

A limited number of strains were used for detection capability of the assay, and specificity testing for Enterobacteriaceae was not performed. Limit of detection has not been evaluated.

Abbreviations

Eae: 

E. coli attaching and effacing

ECA: 

Enterobacterial Common Antigen

EHEC: 

Enterohaemorrhagic E. coli

EPEC: 

Enteropathogenic E. coli

PCR: 

Polymerase chain reaction

IAC: 

Internal amplification control

STEC: 

Shiga toxin producing E. coli

Stx: 

Shiga toxin

TC: 

Total coliforms

Declarations

Authors’ contributions

MA and RS conceived and designed the study, MA performed laboratory work, analysed the data and drafted the manuscript, RS supervised the study and revised the manuscript. Both authors read and approved the final manuscript.

Acknowledgements

We thank Anne Grændsen, The Norwegian Institute for Food and Environmental Analysis, for providing laboratory space to perform part of the laboratory work, Even Heir, The Norwegian Institute of Public Health, for providing pathogenic E. coli strains and Wenche Blix Gundersen, Rikshospitalet University Hospital, for providing Shigella dysenteriae strains. The work presented in this Paper was included in Patent WO 2003/052143, granted by the European Patent Office as EP1466011, and abandoned.

Competing interests

As the related Patent WO 2003/052143 and affiliated, have been abandoned, the authors declare having no competing interests.

Availability of data and materials

All data is made available in this paper and additional files.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Funding

This work was supported by a Norwegian NFR Normal Grant and NIVA.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Norwegian Institute for Water Research (NIVA), 0349 Oslo, Norway
(2)
Department of Biosciences, University of Oslo, Box 1031, Blindern, 0316 Oslo, Norway

References

  1. Diarrhoeal disease. http://www.who.int/mediacentre/factsheets/fs330/en/. Accessed 4 April 2018.
  2. Juhas M. Horizontal gene transfer in human pathogens. Crit Rev Microbiol. 2015;41(1):101–8.View ArticlePubMedGoogle Scholar
  3. Tauxe RV. Emerging foodborne pathogens. Int J Food Microbiol. 2002;78(1):31–41.View ArticlePubMedGoogle Scholar
  4. Chen J, Carpena N, Quiles-Puchalt N, Ram G, Novick RP, Penadés JR. Intra- and inter-generic transfer of pathogenicity island-encoded virulence genes by cos phages. ISME J. 2014;9:1260.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Lai YS, Rosenshine I, Leong JM, Frankel G. Intimate host attachment: enteropathogenic and enterohaemorrhagic Escherichia coli. Cell Microbiol. 2013;15(11):1796–808.PubMedPubMed CentralGoogle Scholar
  6. Schmidt MA. LEEways: tales of EPEC, ATEC and EHEC. Cell Microbiol. 2010;12(11):1544–52.View ArticlePubMedGoogle Scholar
  7. Castro VS, Carvalho RCT, Conte CA, Figuiredo EES. Shiga-toxin producing Escherichia coli: pathogenicity, supershedding, diagnostic methods, occurrence, and foodborne outbreaks. Compr Rev Food Sci Food Saf. 2017;16(6):1269–80.View ArticleGoogle Scholar
  8. Patzi-Vargas S, Zaidi MB, Perez-Martinez I, León-Cen M, Michel-Ayala A, Chaussabel D, Estrada-Garcia T. Diarrheagenic Escherichia coli carrying supplementary virulence genes are an important cause of moderate to severe diarrhoeal disease in Mexico. PLoS Negl Trop Dis. 2015;9(3):e0003510.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Scheutz F, Teel LD, Beutin L, Piérard D, Buvens G, Karch H, Mellmann A, Caprioli A, Tozzoli R, Morabito S, et al. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol. 2012;50(9):2951–63.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Johnson RP, Clarke RC, Wilson JB, Read SC, Rahn K, Renwick SA, Sandhu KA, Alves D, Karmali MA, Lior H, et al. Growing concerns and recent outbreaks involving non-O157:H7 serotypes of verotoxigenic Escherichia coli. J Food Prot. 1996;59(10):1112–22.View ArticleGoogle Scholar
  11. Parsons BD, Zelyas N, Berenger BM, Chui L. Detection, characterization, and typing of Shiga toxin-producing Escherichia coli. Front Microbiol. 2016. https://doi.org/10.3389/fmicb.2016.00478.PubMedPubMed CentralGoogle Scholar
  12. Verstraete K, Van Coillie E, Werbrouck H, Van Weyenberg S, Herman L, Del-Favero J, De Rijk P, De Zutter L, Joris M-A, Heyndrickx M, et al. A qPCR assay to detect and quantify Shiga toxin-producing E. coli (STEC) in cattle and on farms: a potential predictive tool for STEC culture-positive farms. Toxins. 2014;6(4):1201–21.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Brusa V, Galli L, Linares LH, Ortega EE, Lirón JP, Leotta GA. Development and validation of two SYBR green PCR assays and a multiplex real-time PCR for the detection of Shiga toxin-producing Escherichia coli in meat. J Microbiol Methods. 2015;119:10–7.View ArticlePubMedGoogle Scholar
  14. Singh P, Mustapha A. Multiplex real-time PCR assays for detection of eight Shiga toxin-producing Escherichia coli in food samples by melting curve analysis. Int J Food Microbiol. 2015;215:101–8.View ArticlePubMedGoogle Scholar
  15. Salinas-Ibáñez ÁG, Lucero-Estrada C, Chialva C, Zárate JM, Juri-Ayub M, Escudero ME. Design of an internal amplification control for a duplex PCR used in the detection of Shiga toxin producing Escherichia coli in pediatric feces. Mol Cell Probes. 2015;29(6):351–7.View ArticlePubMedGoogle Scholar
  16. Li B, Liu H, Wang W. Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli. BMC Microbiol. 2017;17(1):215.View ArticlePubMedPubMed CentralGoogle Scholar
  17. Wang G, Clark CG, Rodgers FG. Detection in Escherichia coli of the genes encoding the major virulence factors, the genes defining the O157:H7 serotype, and components of the type 2 Shiga toxin family by multiplex PCR. J Clin Microbiol. 2002;40(10):3613–9.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Brandal LT, Lindstedt BA, Aas L, Stavnes TL, Lassen J, Kapperud G. Octaplex PCR and fluorescence-based capillary electrophoresis for identification of human diarrheagenic Escherichia coli and Shigella spp. J Microbiol Methods. 2007;68(2):331–41.View ArticlePubMedGoogle Scholar
  19. Kong RYC, So CL, Law WF, Wu RSS. A sensitive and versatile multiplex PCR system for the rapid detection of enterotoxigenic (ETEC), enterohaemorrhagic (EHEC) and enteropathogenic (EPEC) strains of Escherichia coli. Mar Pollut Bull. 1999;38(12):1207–15.View ArticleGoogle Scholar
  20. Heijnen L, Medema G. Quantitative detection of E. coli, E. coli O157 and other Shiga toxin producing E. coli in water samples using a culture method combined with real-time PCR. J Water Health. 2006;4(4):487–98.View ArticlePubMedGoogle Scholar
  21. Riyaz-Ul-Hassan S, Syed S, Johri S, Verma V, Qazi GN. Application of a multiplex PCR assay for the detection of Shigella, Escherichia coli and Shiga toxin-producing Esch. coli in milk. J Dairy Res. 2009;76(2):188–94.View ArticlePubMedGoogle Scholar
  22. Ashbolt NJ, Grabow WOK, Snozzi M: Indicators of microbial water quality. In: Fewtrell L, Bartram J, editors. Water Quality Guidelines, Standards and Health: assessment of risk and risk management for water-related infectious disease. WHO edition. IWA and WHO; 2001. p. 289–316.Google Scholar
  23. Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988;16(22):10881–90.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Markoulatos P, Siafakas N, Moncany M. Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal. 2002;16(1):47–51.View ArticlePubMedGoogle Scholar
  25. Roux KH. Optimization and troubleshooting in PCR. PCR Methods Appl. 1995;4(5):S185–94.View ArticlePubMedGoogle Scholar
  26. Edwards MC, Gibbs RA. Multiplex PCR. In: Dieffenbach CW, Dveksler GS, editors. PCR primer, a laboratory manual. New York: Cold Spring Harbor Laboratory Press; 1995. p. 157–71.Google Scholar
  27. Kwok S, Chang SY, Sninsky JJ, Wang A. A guide to the design and use of mismatched and degenerate primers. PCR Methods Appl. 1994;3(4):S39–47.View ArticlePubMedGoogle Scholar
  28. Anglès d’Auriac M. Development of microbiological molecular diagnostic techniques for the rapid screening and identification of selected human bacterial pathogens and indicators. Oslo: University of Oslo; 2009.Google Scholar
  29. Sarkar G, Kapelner S, Sommer SS. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 1990;18(24):7465.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Abu Al-Soud W, Radstrom P. Effects of amplification facilitators on diagnostic PCR in the presence of blood, feces, and meat. J Clin Microbiol. 2000;38(12):4463–70.PubMedPubMed CentralGoogle Scholar
  31. Kunin CM. Separation, characterization, and biological significance of a common antigen in Enterobacteriaceae. J Exp Med. 1963;85:541–8.Google Scholar
  32. Kuhn H-M, Meier-Dieter U, Mayer H. ECA, the enterobacterial common antigen. FEMS Microbiol Lett. 1988;54(3):195–222.View ArticleGoogle Scholar
  33. Ohta M, Ina K, Kusuzaki K, Kido N, Arakawa Y, Kato N. Cloning and expression of the rfe-rff gene cluster of Escherichia coli. Mol Microbiol. 1991;5(8):1853–62.View ArticlePubMedGoogle Scholar
  34. Rick PD, Silver RP: Enterobacterial Common Antigen and capsular polysaccharides. In: Neidhardt FC, editor. Escherichia coli and Salmonella cellular and molecular biology. vol. 1, 2nd ed. Washington, DC: American Society of Microbiology; 1996. p. 104–22.Google Scholar
  35. Reeves PR, Hobbs M, Valvano MA, Skurnik M, Whitfield C, Coplin D, Kido N, Klena J, Maskell D, Raetz CR, et al. Bacterial polysaccharide synthesis and gene nomenclature. Trends Microbiol. 1996;4(12):495–503.View ArticlePubMedGoogle Scholar
  36. Malkamaki M. Antibodies to the enterobacterial common antigen: standardization of the passive hemagglutination test and levels in normal human sera. J Clin Microbiol. 1981;13(6):1074–9.PubMedPubMed CentralGoogle Scholar
  37. Hubner I, Steinmetz I, Obst U, Giebel D, Bitter-Suermann D. Rapid determination of members of the family Enterobacteriaceae in drinking water by an immunological assay using a monoclonal antibody against enterobacterial common antigen. Appl Environ Microbiol. 1992;58(9):3187–91.PubMedPubMed CentralGoogle Scholar
  38. Ito K, Iida M, Yamazaki M, Moriya K, Moroishi S, Yatsuyanagi J, Kurazono T, Hiruta N, Ratchtrachenchai O-A. Intimin types determined by heteroduplex mobility assay of Intimin gene (eae)-positive Escherichia coli strains. J Clin Microbiol. 2007;45(3):1038–41.View ArticlePubMedPubMed CentralGoogle Scholar
  39. Adu-Bobie J, Frankel G, Bain C, Goncalves AG, Trabulsi LR, Douce G, Knutton S, Dougan G. Detection of intimins alpha, beta, gamma, and delta, four intimin derivatives expressed by attaching and effacing microbial pathogens. J Clin Microbiol. 1998;36(3):662–8.PubMedPubMed CentralGoogle Scholar
  40. Oswald E, Schmidt H, Morabito S, Karch H, Marches O, Caprioli A. Typing of Intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new Intimin variant. Infect Immun. 2000;68(1):64–71.View ArticlePubMedPubMed CentralGoogle Scholar
  41. Yu J, Kaper JB. Cloning and characterization of the eae gene of enterohaemorrhagic Escherichia coli O157:H7. Mol Microbiol. 1992;6(3):411–7.View ArticlePubMedGoogle Scholar
  42. Elliott SJ, Wainwright LA, McDaniel TK, Jarvis KG, Deng YK, Lai LC, McNamara BP, Donnenberg MS, Kaper JB. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol Microbiol. 1998;28(1):1–4.View ArticlePubMedGoogle Scholar
  43. Beutin L, Krause G, Zimmermann S, Kaulfuss S, Gleier K. Characterization of Shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3-year period. J Clin Microbiol. 2004;42(3):1099–108.View ArticlePubMedPubMed CentralGoogle Scholar
  44. Ramachandran V, Hornitzky MA, Bettelheim KA, Walker MJ, Djordjevic SP. The common ovine Shiga toxin 2-containing Escherichia coli serotypes and human isolates of the same serotypes possess a Stx2d toxin type. J Clin Microbiol. 2001;39(5):1932–7.View ArticlePubMedPubMed CentralGoogle Scholar
  45. Franke S, Harmsen D, Caprioli A, Pierard D, Wieler LH, Karch H. Clonal relatedness of Shiga-like toxin-producing Escherichia coli O101 strains of human and porcine origin. J Clin Microbiol. 1995;33(12):3174–8.PubMedPubMed CentralGoogle Scholar
  46. Schmidt H, Scheef J, Morabito S, Caprioli A, Wieler LH, Karch H. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl Environ Microbiol. 2000;66(3):1205–8.View ArticlePubMedPubMed CentralGoogle Scholar
  47. Morabito S, Dell’Omo G, Agrimi U, Schmidt H, Karch H, Cheasty T, Caprioli A. Detection and characterization of Shiga toxin-producing Escherichia coli in feral pigeons. Vet Microbiol. 2001;82(3):275–83.View ArticlePubMedGoogle Scholar
  48. Sonntag AK, Zenner E, Karch H, Bielaszewska M. Pigeons as a possible reservoir of Shiga toxin 2f-producing Escherichia coli pathogenic to humans. Berl Munch Tierarztl Wochenschr. 2005;118(11–12):464–70.PubMedGoogle Scholar
  49. Baranzoni GM, Fratamico PM, Gangiredla J, Patel I, Bagi LK, Delannoy S, Fach P, Boccia F, Anastasio A, Pepe T. Characterization of Shiga toxin subtypes and virulence genes in porcine Shiga toxin-producing Escherichia coli. Front Microbiol. 2016;7:574.View ArticlePubMedPubMed CentralGoogle Scholar
  50. Mellmann A, Bielaszewska M, Zimmerhackl LB, Prager R, Harmsen D, Tschape H, Karch H. Enterohemorrhagic Escherichia coli in human infection: in vivo evolution of a bacterial pathogen. Clin Infect Dis. 2005;41(6):785–92.View ArticlePubMedGoogle Scholar
  51. Bielaszewska M, Prager R, Köck R, Mellmann A, Zhang W, Tschäpe H, Tarr PI, Karch H. Shiga toxin gene loss and transfer in vitro and in vivo during enterohemorrhagic Escherichia coli O26 infection in humans. Appl Environ Microbiol. 2007;73(10):3144–50.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Fach P, Perelle S, Dilasser F, Grout J. Comparison between a PCR-ELISA test and the vero cell assay for detecting Shiga toxin-producing Escherichia coli in dairy products and characterization of virulence traits of the isolated strains. J Appl Microbiol. 2001;90(5):809–18.View ArticlePubMedGoogle Scholar
  53. Karch H, Meyer T. Single primer pair for amplifying segments of distinct Shiga-like-toxin genes by polymerase chain reaction. J Clin Microbiol. 1989;27(12):2751–7.PubMedPubMed CentralGoogle Scholar
  54. Lin Z, Kurazono H, Yamasaki S, Takeda Y. Detection of various variant verotoxin genes in Escherichia coli by polymerase chain reaction. Microbiol Immunol. 1993;37(7):543–8.View ArticlePubMedGoogle Scholar
  55. Paton AW, Paton JC, Goldwater PN, Manning PA. Direct detection of Escherichia coli Shiga-like toxin genes in primary fecal cultures by polymerase chain reaction. J Clin Microbiol. 1993;31(11):3063–7.PubMedPubMed CentralGoogle Scholar
  56. Read SC, Clarke RC, Martin A, De Grandis SA, Hii J, McEwen S, Gyles CL. Polymerase chain reaction for detection of verocytotoxigenic Escherichia coli isolated from animal and food sources. Mol Cell Probes. 1992;6(2):153–61.View ArticlePubMedGoogle Scholar
  57. Yamasaki S, Lin Z, Shirai H, Terai A, Oku Y, Ito H, Ohmura M, Karasawa T, Tsukamoto T, Kurazono H, et al. Typing of verotoxins by DNA colony hybridization with poly- and oligonucleotide probes, a bead-enzyme-linked immunosorbent assay, and polymerase chain reaction. Microbiol Immunol. 1996;40(5):345–52.View ArticlePubMedGoogle Scholar
  58. Ge B, Zhao S, Hall R, Meng J. A PCR-ELISA for detecting Shiga toxin-producing Escherichia coli. Microbes Infect. 2002;4(3):285–90.View ArticlePubMedGoogle Scholar
  59. Kimata K, Shima T, Shimizu M, Tanaka D, Isobe J, Gyobu Y, Watahiki M, Nagai Y. Rapid categorization of pathogenic Escherichia coli by multiplex PCR. Microbiol Immunol. 2005;49(6):485–92.View ArticlePubMedGoogle Scholar
  60. Fratamico P, Strobaugh TP. Simultaneous detection of Salmonella spp. and Escherichia coli O157:H7 by multiplex PCR. J Ind Microbiol Biotechnol. 1998;21:92–8.View ArticleGoogle Scholar
  61. Osek J, Dacko J. Development of a PCR-based method for specific identification of genotypic markers of Shiga toxin-producing Escherichia coli strains. Zoonoses Public Health. 2001;48(10):771–8.Google Scholar
  62. Toma C, Lu Y, Higa N, Nakasone N, Chinen I, Baschkier A, Rivas M, Iwanaga M. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J Clin Microbiol. 2003;41(6):2669.View ArticlePubMedPubMed CentralGoogle Scholar
  63. Hervert CJ, Martin NH, Boor KJ, Wiedmann M. Survival and detection of coliforms, Enterobacteriaceae, and gram-negative bacteria in Greek yogurt. J Dairy Sci. 2017;100(2):950–60.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2018

Advertisement

BMC Research Notes

ISSN: 1756-0500

Contact us