Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Research Notes

Open Access

The characterisation of microsatellite markers reveals tetraploidy in the Greater Water Parsnip, Sium latifolium (Apiaceae)

BMC Research Notes201710:204

https://doi.org/10.1186/s13104-017-2528-6

Received: 26 April 2016

Accepted: 2 June 2017

Published: 12 June 2017

Abstract

Background

The Greater Water Parsnip, Sium latifolium (Apiaceae), is a marginal aquatic perennial currently endangered in England and consequently the focus of a number of conservation translocation projects. Microsatellite markers were developed for S. latifolium to facilitate comparison of genetic diversity and composition between natural and introduced populations.

Results

We selected 65 S. latifolium microsatellite (MiSeq) sequences and designed primer pairs for these. Primer sets were tested in 32 individuals. We found 15 polymorphic loci that amplified consistently. For the selected 15 loci, the number of alleles per locus ranged from 8 to 17. For all loci, S. latifolium individuals displayed up to four alleles indicating polyploidy in this species.

Conclusions

These are the first microsatellite loci developed for S. latifolium and each individual displayed 1–4 alleles per locus, suggesting polyploidy in this species. These markers provide a valuable resource in evaluating the population genetic composition of this endangered species and thus will be useful for guiding conservation and future translocations of the species.

Keywords

Sium latifolium MicrosatellitePolyploidPlant translocationSimple sequence repeat (SSR)Simple tandem repeat (STR)

Background

Plant translocation is a common occurrence, with an estimated 600 species of plants having been relocated as population introduction, re-introduction or augmentation [1, 2]. Whilst a tactic for large scale habitat restoration is through the planting of multiple species, translocation is also an important conservation strategy for specific plants at risk [3]. Guidance on plant translocations recommends consideration of genetic composition [4] however projects infrequently utilise genetic techniques in planning and evaluating reintroductions ([5]; although see [6, 7] as examples).

One species that has been widely translocated in the UK is Sium latifolium L., the Greater Water Parsnip. S. latifolium is a herbaceous, marginal aquatic perennial in the plant family Apiaceae, tribe Oenantheae; one of nine species within the genus, it is found across Europe and Asia [8]. With large, conspicuous, umbel inflorescences and growing to 2 m tall [9], S. latifolium was once a noticeable dominant in wetland areas of England, where it grows in habitats of fen, pond margins and grazing marsh ditches [10]. However, the population of S. latifolium has much declined over the past 40 years, due to habitat loss and change in wetland management [11]. It is now classified as ‘endangered’ on the vascular plant red list for England [12]. As a response to the marked decline in populations, conservation projects involving translocations of S. latifolium have occurred independently in at least seven counties of England, re-introducing the species in regions where it has been lost or declined, however the success of these translocations has been mixed.

The goal of this study was to generate a suite of microsatellite markers specifically developed for S. latifolium in order to evaluate and compare the genetic composition of populations, both old and new, with the view to guide practitioners in the best approaches for further translocations of this species. With many independent reintroductions it can also be used as a case study for exploring broader questions relating to genetic management of plant translocations.

Results

Samples of S. latifolium were collected in May 2012 and August 2013 (Table 1), permission for sampling was obtained from the landowner of each site. Three leaflets per plant were preserved in silica gel and stored at room temperature. Prior to extraction, 10–20 mg of leaf tissue was frozen overnight at −80 °C before being homogenised at 1000 Hz for 3 min using a GenoGrinder 2000 (Spex CertiPrep, Metuchen, NJ USA). Genomic DNA was isolated employing a cetyltrimethyl ammonium bromide (CTAB) protocol [13], with the addition of 1% polyvinyl pyrrolidone (PVP) to the isolation buffer to remove polyphenols [14]. Once washed and air-dried, DNA was re-suspended in 100 µl low TE (10 mM Tris–HCl, 0.1 mM EDTA, pH 8.4) and subsequently diluted to 100 ng/µl with low TE.
Table 1

Details of Sium latifolium samples used for testing of the microsatellite primer sets and assessing the loci

Sample

Population

Location

Individual from which the microsatellite sequences were isolated

 I50

Wickhampton Marshes, Norfolk

TG 43535 05018

Samples used for PCR temperature gradient testing

 G15

Sutton Fen, Norfolk

TG 36511 22999

 I08

Wickhampton Marshes, Norfolk

TG 43433 04160

Six unrelated individuals used initially to test for polymorphism

 B12

Tophill Low, East Riding of Yorkshire

TA 07754 49673

 C12

Ouse Washes, Cambridgeshire

TL 49433 89016

 D15

Romney Marsh, Kent

TQ 97837 31120

 E33

Southlake Moor, Somerset

ST 36427 30272

 F20

Cantley Marsh, Norfolk

TG 37352 03459

 G10

Sutton Fen, Norfolk

TG 36881 23345

24 individuals from one population

 I01

Wickhampton Marshes, Norfolk

TG 43381 04180

 I02

Wickhampton Marshes, Norfolk

TG 43318 04021

 I03

Wickhampton Marshes, Norfolk

TG 43532 04032

 I04

Wickhampton Marshes, Norfolk

TG 43193 03934

 I05

Wickhampton Marshes, Norfolk

TG 43408 03171

 I06

Wickhampton Marshes, Norfolk

TG 43471 04113

 I07

Wickhampton Marshes, Norfolk

TG 43441 04132

 I10

Wickhampton Marshes, Norfolk

TG 43921 04759

 I11

Wickhampton Marshes, Norfolk

TG 44163 04634

 I13

Wickhampton Marshes, Norfolk

TG 44177 04656

 I15

Wickhampton Marshes, Norfolk

TG 43295 03952

 I16

Wickhampton Marshes, Norfolk

TG 43325 04226

 I17

Wickhampton Marshes, Norfolk

TG 43316 04050

 I18

Wickhampton Marshes, Norfolk

TG 43291 03947

 I19

Wickhampton Marshes, Norfolk

TG 43291 04157

 I20

Wickhampton Marshes, Norfolk

TG 43252 03931

 I22

Wickhampton Marshes, Norfolk

TG 43285 04125

 I24

Wickhampton Marshes, Norfolk

TG 43295 03961

 I25

Wickhampton Marshes, Norfolk

TG 44129 04558

 I26

Wickhampton Marshes, Norfolk

TG 43288 04151

 I27

Wickhampton Marshes, Norfolk

TG 43299 04101

 I28

Wickhampton Marshes, Norfolk

TG 43250 03931

 I29

Wickhampton Marshes, Norfolk

TG 43663 04256

 I30

Wickhampton Marshes, Norfolk

TG 44131 04556

Identification code for each sample, site name and county of sampled population, British national grid reference for sample location

The microsatellite library was prepared from one individual sampled at Wickhampton Marshes, Norfolk, UK (52°35′N 1°35′E; sample identification code = I50). The library was enriched for microsatellites, using magnetic beads in the hybridisation [15, 16]. An Illumina paired-end library was created using 1 µg of the repeat-enriched genomic DNA. The SureSelect Library Prep Kit, ILM (Agilent Technologies Inc. Santa Clara, California) protocol was followed and 2 × 250 bp paired-end sequencing conducted using a MiSeq Benchtop Sequencer (Illumina Inc. San Diego, California).

Sequences with at least ten repeats were selected for primer design; primer sets were designed to amplify the microsatellite regions using PRIMER3 v 0.4.0 [17]. Specifications for primer selection were set at a primer length of 16–36 base pairs (optimum 20 bp), an optimal primer melting temperature of 60 °C, (min–max of 59–61 °C), a maximum of 0.5 °C between primers, presence of a 3′ GC clamp, a maximum poly-X of three and the default settings for all other parameters. Sixty-five primer sets were designed. The 5′ end of each forward primer was fluorescently-labelled with HEX or 6-FAM.

Microsatellites were amplified in 2-µl PCRs, including 1 µl (100 ng) genomic DNA (air dried), 2 µl primer mix (forward and reverse primer at 0.2 µM) and 1 µl Qiagen Multiplex PCR Master Mix including HotStar Taq DNA polymerase (Qiagen Inc.). Covered with a thin layer of mineral oil, products were amplified under the following profile: incubate at 95 °C for 15 min, followed by 35 cycles of 94 °C for 30 s, selected primer temperature (51, 53 or 58 °C, see Table 2) for 1 min 30 s and 72 °C for 1 min 30 s, and finally incubated at 72 °C for 10 min. The optimum annealing temperature for each primer set was initially selected by testing a temperature gradient on two samples (Table 1), this varied the annealing temperature for each well across 12 rows from 50 to 70 °C. PCR products were diluted with double-deionized H2O (1:160). They were visualised on an ABI 3730 48-well capillary DNA Analyser (Applied Biosystems Inc. California, USA) and sized with a ROX-labelled size standard. Allele sizes were scored using GENEMAPPER v3.7 software (Applied Biosystems Inc. California, USA).
Table 2

Details for the 15 selected, validated Sium latifolium microsatellite loci

Locus

Sequence identifier and accession no.

Primer sequences (5′–3′)

Repeat motif

T (°C)

Sla01

GWP00014, LN849725

F: [6FAM]AGACTTGTATGTCCTGCATTATGTTC

R: CAGCTGGTGAAGCCAATTTAG

(GT)13

58

Sla02

GWP00025, LN849726

F: [HEX]TTGCCTCAAGTGCAGAACAG

R: CAACCACTTACATATGTTCACAATACC

(CT)15

58

Sla03

GWP00030, LN849727

F: [6FAM]ACCAATGACAAGTGGGTTCC

R: CCCAAGATTTCCTTGAAGTACAG

(CA)28

53

Sla04

GWP00089, LN849728

F: [HEX]GATTCCCGATCTCCAATTCC

R: CGCGACATCGAAGAGTTTG

(CA)13

53

Sla05

GWP00130, LN849729

F: [6FAM]AGAAGCACGCTATTGCACTG

R: CATTTGTCAGTTGTCACATACCC

(GT)10

58

Sla06

GWP00133, LN849730

F: [6FAM]TTGCAAGGAAACTGAGACCAC

R: TGGACATTGTACCAGCTACCC

(CT)14

51

Sla07

GWP00178, LN849731

F: [6FAM]GGACATCTAAGCATAAAGTGCAATAAC

R: TTGTTTCTAGCAGAGGTAGCTTGAC

(CA)18

58

Sla08

GWP00226, LN849732

F: [HEX]CAGATGGATAGTTGAAACCAAGTG

R: TTAAGTTAGACAAGCGGCCTTC

(CA)12

51

Sla09

GWP00268, LN849733

F: [HEX]CAGCAAGAATTGCCAATCG

R: AATGGTGAAGGGAAATGCTG

(GT)12

58

Sla10

GWP00318,LN849734

F: [HEX]TTACTTGCCCACGCTTCTG

R: TCTTCTAAAGCAGGGGAGTACG

(CT)15

51

Sla11

GWP00319, LN849735

F: [6FAM]TGATACGGTGGATGATGAGC

R: TGCATTATATGCGTCAACTGG

(GT)12 (GA)8

58

Sla12

GWP00373, LN849736

F: [6FAM]GCCACAGTAGATCCATTACTCAAC

R: TTTGACACAGATTGGAATCCTC

(GT)16

51

Sla13

GWP00423, LN849737

F: [HEX]CCTTAACTAAAGACTAAAGACTGTGGAAC

R: ACTTGGTCGGTTATGTTGTGG

(GA)13

58

Sla14

GWP03443, LN849738

F: [6FAM]CTGGCAAACACACGCAAC

R: TTTCTTTGTTTGGGTTTGATCTC

(GA)13

58

Sla15

GWP03601, LN849739

F: [6FAM]TTGTAAACGCCCTTACCATTG

R: AATAAACCATGAACAGATGAAGATTG

(GT)15

51

Microsatellite loci, sequence identifier and EMBL/EBI accession number, sequence of primers, repeat motifs, optimum primer annealing temperatures (T °C)

All primer sets were initially tested in six unrelated individuals (Table 1), each from a different geographic population in the UK. Markers failing to amplify or appearing monomorphic at this stage were discarded. The remaining primer sets were then tested in a further 24 individuals from the same population as the individual sequenced to isolate the microsatellites (Wickhampton Marshes, England; I50; Table 1) to fully evaluate their characteristics and usefulness. Overall, of the 65 primer pairs tested, 15 (23%) loci were polymorphic and easily scoreable (Table 2). The remainder were monomorphic (18%), not useable due to stutter and scoring difficulty (31%) or had poor/no amplification (28%).

To estimate genotyping error, extraction and scoring for a proportion of individuals was repeated to compare the data. The mean scoring error was found to be 0.02% (calculated as per [18]). All of the 15 markers tested displayed more than 2 alleles in multiple individuals and all individuals tested displayed more than 2 alleles in several markers, suggesting S. latifolium is polyploid (for data, see Additional file 1). A maximum of 4 alleles were observed per individual indicating tetraploidy in this species (see Additional file 2). Characteristics of each microsatellite locus were calculated for S. latifolium samples using the R package polysat [19, 20]. The number of alleles per locus ranged from 8 to 17 and the mean average number of alleles was 12 (Table 3). Observed heterozygosity per locus ranged from 0.88 to 1.00, with a mean average of 0.99 (Table 3). Due to polyploidy and unknown inheritance patterns, deviation from Hardy–Weinberg equilibrium could not be calculated nor could the frequency of null alleles be estimated [21].
Table 3

Characterisation of 15 dinucleotide microsatellite loci for the Greater Water Parsnip Sium latifolium, all tested on 24 individuals sampled at Wickhampton Marshes, reveals tetraploidy in this species

Locus

Fluoro dye

Exp. I50 (bp),

Obs. I50 (bp).

N

K

Observed allele size range (bp)

Number of individuals with 1–2 alleles

Number of individuals with 3–4 alleles

Ho

Sla01

[6FAM]

192

191, 193, 195

23

12

189–213

0

23

1.000

Sla02

[HEX]

154

132, 150, 154, 164

24

17

132–180

4

20

1.000

Sla03

[6FAM]

241

230, 232, 240

23

16

202–242

10

13

1.000

Sla04

[HEX]

196

180, 188, 194*

24

9

180–204

9

15

1.000

Sla05

[6FAM]

248

244, 248, 250

23

8

242–254

8

15

0.958

Sla06

[6FAM]

154

130, 138, 150, 154

23

9

130–158

5

18

0.958

Sla07

[6FAM]

228

203, 207, 224*

24

12

203–224

2

22

1.000

Sla08

[HEX]

115

104, 110, 112*

24

15

94–136

3

21

1.000

Sla09

[HEX]

180

168, 182*

24

10

166–186

21

3

0.875

Sla10

[HEX]

142

132, 141

23

13

128–170

14

9

1.000

Sla11

[6FAM]

148

136, 142, 148

22

11

128–156

8

14

1.000

Sla12

[6FAM]

107

92, 106, 108, 112

22

13

90–116

3

19

1.000

Sla13

[HEX]

121

117, 128*

23

11

110–136

11

12

1.000

Sla14

[6FAM]

161

158, 160, 168

22

14

134–176

4

18

1.000

Sla15

[6FAM]

106

101, 105, 107, 119

23

12

83–119

7

19

1.000

Microsatellite loci, expected and observed allele sizes (with the sequenced allele underlined*; bp) of individual from which the microsatellite sequences were isolated (individual I50, sampled at Wickhampton Marshes, Norfolk), number of individuals successfully genotyped (n), number of alleles (k), allele size range (bp), observed heterozygosity (Ho). Exp. I50 (bp), Expected allele size of I50, Obs. I50 (bp), Observed amplified allele sizes of individual, I50, *Minor size differences (bp) were observed between the expected size of the allele (based on sequencing) and observed allele size (based on ABI genotyping). This error is caused by (1) the presence of the fluorescent dye label (6FAM and HEX) and/or (2) sequence misalignment due to the repeat region when creating the consensus sequence from the two paired-end complementary sequences

Initial measures of genetic diversity were calculated for the genotyped population (Wickhampton Marshes) using the programme GenoDive [22]. In this population, the mean average number of alleles per locus was 9.13 and observed heterozygosity was 0.976. Genetic distances between individuals within the library population were calculated (Bruvo distance, R package polysat [20, 23]) and visualised by ordination (R package Vegan [24]). The microsatellite markers revealed variation in the genetic distance between individuals within a single population and identified clusters of individuals with similar genotypes (Fig. 1).
Fig. 1

Genetic distance between 25 individuals sampled at Wickhampton Marshes, Norfolk, UK. Dissimilarity calculated on Bruvo Distance. NMDS plot stress = 0.217

Conclusions

We have successfully developed the first set of microsatellite markers for S. latifolium. The 15 loci amplified reliably and have been shown to be sufficiently variable for distinguishing between individuals (Fig. 1). These will be helpful in providing a genetic context for planning and managing further reintroductions of S. latifolium. Additionally, using S. latifolium as an example species, these microsatellite loci will also be helpful in interpreting the effects of genetic diversity and source population composition on plant reintroductions.

We also found each S. latifolium individual genotyped displayed 1–4 alleles. We conclude that this is evidence of tetraploidy, a trait not previously reported in this species. Polyploidy occurs occasionally through the Apiaceae family, in just over 10% of species [25]. In other species of Sium intraspecific variation in ploidy levels has been recorded, with local polyploid cytotypes found within a diploid species [26]. A chromosome count of 12 or 20 has been reported in S. latifolium [27]. As these previous cytological studies used specimens from continental Europe, the chromosomal characteristics of UK S. latifolium is unknown. Differences in records suggests that there may be variation within the species and all reported counts are a multiple of 4, indicating that tetraploidy is possible. Additional cytological analyses would also consider historical polyploidy or aneuploidy as causes of the multiple alleles observed. Further work on S. latifolium is needed to determine the nature of the ploidy (i.e. the inheritance type) and the patterns of ploidy throughout the species’ geographic range.

Abbreviations

CTAB: 

cetyltrimethyl ammonium bromide

DNA: 

deoxyribonucleic acid

EDTA: 

ethylenediamine tetraacetic acid

PCR: 

polymerase chain reaction

PVP: 

polyvinyl pyrrolidone

TE: 

Tris–EDTA

UK: 

United Kingdom

Declarations

Authors’ contributions

ND performed DNA extraction, designed primers, optimised PCR reactions, selected and validated markers, conducted data analysis, and drafted the manuscript. GH constructed the microsatellite-enriched genomic library, designed primers and helped in optimising PCR reactions and interpreting results. DD participated in primer design, marker selection and validation, discussion of results, and revised all drafts of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Microsatellite isolation and genotyping was performed at the NERC Biomolecular Analysis Facility at the University of Sheffield, UK. The authors thank J. Dawe and D. Grafham of Sheffield Diagnostics Genetics Service for performing the MiSeq sequencing at The Children’s Hospital Sheffield supported by the Sheffield Children’s NHS Trust, UK.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The microsatellite sequences are available through the European Molecular Biology Laboratory (EMBL/EBI) European Nucleotide Archive (see http://www.ebi.ac.uk/ena); ENA Accession Numbers LN849725 to LN849739. The data generated and analysed during the study (sample genotypes) are included in the Additional files of this report.

Funding

This research was supported by the Natural Environment Research Council (NERC), UK (Award NBAF769). ND was supported by NERC Grant NE/1018336/1 and the Somerset Wildlife Trust, UK.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
School of Biological Sciences, University of Bristol
(2)
NERC Biomolecular Analysis Facility, Department of Animal and Plant Sciences, University of Sheffield

References

  1. Dalrymple SE, Stewart GB, Pullin AS. Are reintroductions an effective way of mitigating against plant extinctions? CEE review 07-008 (SR32). Collaboration for environmental evidence. 2011. http://www.environmentalevidence.org/SR32.html.
  2. Godefroid S, Vanderborght T. Plant reintroductions: the need for a global database. Biodivers Conserv. 2011;20:3683–8.View ArticleGoogle Scholar
  3. Maunder M. Plant reintroduction: an overview. Biodivers Conserv. 1992;1:51–61.Google Scholar
  4. IUCN/SSC. Guidelines for reintroductions and other conservation translocations. Gland: IUCN Species Survival Commission; 2013.Google Scholar
  5. Weeks AR, Sgro CM, Young AG, Frankham R, Mitchell NJ, Miller KA, Byrne M, Coates DJ, Eldridge MDB, Sunnucks P, Breed MF, James EA, Hoffmann AA. Assessing the benefits and risks of translocations in changing environments: a genetic perspective. Evol Appl. 2011;4(6):709–25.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Gonzalez-Perez MA, Lledo MD, Lexer C, Fay M, Marrero M, Banares-Baudet A, Carque E, Sosa PA. Genetic diversity and differentiation in natural and reintroduced populations of Bencomia exstipulata and comparisons with B. caudata (Rosaceae) in the Canary Islands: an analysis using microsatellites. Bot J Linn Soc. 2009;160:429–41.View ArticleGoogle Scholar
  7. Lloyd MW, Burnett RK, Engelhardt KAM, Neel MC. Does genetic diversity of restored sites differ from natural sites? A comparison of Vallisneria americana (Hydrocharitaceae) populations within the Chesapeake Bay. Conserv Genet. 2012;13:753–65.View ArticleGoogle Scholar
  8. Spalik K, Downie SR. The evolutionary history of Sium sensu lato (Apiaceae): dispersal, vicariance, and domestication as inferred from ITS rDNA phylogeny. Am J Bot. 2006;93:747–61.View ArticlePubMedGoogle Scholar
  9. Stace C. New flora of the British Isles. 3rd ed. Cambridge: Cambridge University Press; 2010.Google Scholar
  10. Preston C, Pearman D, Dines T. New atlas of the British and Irish flora. Oxford: Oxford University Press; 2002.Google Scholar
  11. Stewart ADP, Preston C. Scarce plants in Britain. Peterborough: Joint Nature Conservation Committee; 1994.Google Scholar
  12. Stroh P, Leach S, August T, Walker K, Pearman D, Rumsey F, Harrower C, Fay M, Martin J, Pankhurst T, Preston C, Taylor I. A vascular plant red list for England. Bristol: Botanical Society of Britain and Ireland; 2014.Google Scholar
  13. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 1987;19:11–5.Google Scholar
  14. Maliyakal EJ. An efficient method for isolation of RNA and DNA from plants containing polyphenolics. Nucleic Acids Res. 1992;20:2381.View ArticleGoogle Scholar
  15. Armour JAL, Neumann R, Gobert S, Jeffreys AJ. Isolation of human simple repeat loci by hybridization selection. Hum Mol Genet. 1994;3:599–605.View ArticlePubMedGoogle Scholar
  16. Glenn TC, Schable NA. Isolating microsatellite DNA loci. Method Enzymol. 2005;395:202–22.Google Scholar
  17. Rozen S, Skaletsky HJ. Primer 3 on the WWW for general users and for biologist programers. In: Misener S, Krawetz S, editors. Methods in molecular biology: bioinformatics methods and protocols. Totawa: Humana Press Inc.; 1999. p. 1999.Google Scholar
  18. Hoffman JI, Amos W. Microsatellite genotyping errors: detection approaches, common sources and consequences for paternal exclusion. Mol Ecol. 2005;14:599–612.View ArticlePubMedGoogle Scholar
  19. R Development Core Team R. R. A language and environment for statistical computing. R foundation for statistical. Computing. 2011;1:409.Google Scholar
  20. Clark LV, Jasieniuk M. Polysat: an R package for polyploid microsatellite analysis. Mol Ecol Resour. 2011;11(3):562–6.View ArticlePubMedGoogle Scholar
  21. Dufresne F, Stift M, Vergilino R, Mable BK. Recent progress and challenges in population genetics of polyploid organisms: an overview of current state-of-the-art molecular and statistical tools. Mol Ecol. 2014;23:40–69.View ArticlePubMedGoogle Scholar
  22. Meirmans PG, Van Tienderen PH. GENOTYPE and GENODIVE: two programs for the analysis of genetic diversity of asexual organisms. Mol Ecol Notes. 2004;4:792–4.View ArticleGoogle Scholar
  23. Bruvo R, Michiels NK, D’Souza TG, Schulenburg H. A simple method for calculation of microsatellite genotype distances irrespective of ploidy level. Mol Ecol. 2004;13:2101–6.View ArticlePubMedGoogle Scholar
  24. Oksanen J, Blanchet FG, Kindt R, Legendre P, O’Hara RB, Simpson GL, Solymos P, Stevens MHH, Wagner H. Vegan: community ecology package, R package version 2.0–4. 2012. http://CRAN.R-project.org/package=vegan. Accessed 7 Apr 2016.
  25. Wood TE, Takebayashi N, Barker MS, Mayrose I, Greenspoon PB, Rieseberg LH. The frequency of polyploid speciation in vascular plants. P Natl Acad Sci USA. 2009;106(33):13875–9.View ArticleGoogle Scholar
  26. Kumar S, Jeelani SM, Rani S, Kumari S, Gupta RC. Cytological evaluation of Apiaceae Lindl from Western Himalayas. Cytol Genet. 2014;48(4):250–7.View ArticleGoogle Scholar
  27. Rice A, Glick L, Abadi S, Einhorn M, Kopelman N, Salman-Minkov A, Mayzel J, Chay O, Mayrose I. The Chromosome Counts Database (CCDB)—a community resource of plant chormosome numbers. New Phytol. 2015;206:19–26.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2017

Advertisement