Skip to content

Advertisement

  • Research article
  • Open Access

Identification of putative adhesins of Actinobacillus suis and their homologues in other members of the family Pasteurellaceae

BMC Research Notes20158:675

https://doi.org/10.1186/s13104-015-1659-x

Received: 17 July 2015

Accepted: 2 November 2015

Published: 14 November 2015

Abstract

Background

Actinobacillus suis disease has been reported in a wide range of vertebrate species, but is most commonly found in swine. A. suis is a commensal of the tonsils of the soft palate of swine, but in the presence of unknown stimuli it can invade the bloodstream, causing septicaemia and sequelae such as meningitis, arthritis, and death. It is genotypically and phenotypically similar to A. pleuropneumoniae, the causative agent of pleuropneumonia, and to other members of the family Pasteurellaceae that colonise tonsils. At present, very little is known about the genes involved in attachment, colonisation, and invasion by A. suis (or related members of the tonsil microbiota).

Results

Bioinformatic analyses of the A. suis H91-0380 genome were done using BASys and blastx in GenBank. Forty-seven putative adhesin-associated genes predicted to encode 24 putative adhesins were discovered. Among these are 6 autotransporters, 25 fimbriae-associated genes (encoding 3 adhesins), 12 outer membrane proteins, and 4 additional genes (encoding 3 adhesins). With the exception of 2 autotransporter-encoding genes (aidA and ycgV), both with described roles in virulence in other species, all of the putative adhesin-associated genes had homologues in A. pleuropneumoniae. However, the majority of the closest homologues of the A. suis adhesins are found in A. ureae and A. capsulatus—species not known to infect swine, but both of which can cause systemic infections.

Conclusions

A. suis and A. pleuropneumoniae share many of the same putative adhesins, suggesting that the different diseases, tissue tropism, and host range of these pathogens are due to subtle genetic differences, or perhaps differential expression of virulence factors during infection. However, many of the putative adhesins of A. suis share even greater homology with those of other pathogens within the family Pasteurellaceae. Similar to A. suis, these pathogens (A. capsulatus and A. ureae) cause systemic infections and it is tempting to speculate that they employ similar strategies to invade the host, but more work is needed before that assertion can be made. This work begins to examine adhesin-associated factors that allow some members of the family Pasteurellaceae to invade the bloodstream while others cause a more localised infection.

Keywords

  • Actinobacillus suis
  • Pasteurellaceae
  • Adhesins
  • Bioinformatics

Background

Actinobacillus suis, a member of the family Pasteurellaceae, is a Gram negative, facultative anaerobe, and a common commensal of the tonsils of the soft palate of swine [1]. However, under unknown conditions, it can invade the bloodstream of animals of all ages, resulting in septicaemia and sequelae such as meningitis, arthritis, and pneumonia [2]. A. pleuropneumoniae is a primary pathogen of swine that also colonises the upper respiratory tract and causes a contagious pleuropneumonia [3]. A. pleuropneumoniae and A. suis share many of the same virulence factors, including virtually identical ApxI and ApxII toxins (though there are differences in the apxIBD transport genes), iron acquisition proteins including transferrin-binding proteins, urease, lipopolysaccharide, and adhesins [4]. Despite many similarities, A. pleuropneumoniae and A. suis cause different diseases in swine, and A. suis has a broader host range [5].

Little is known about the virulence factors of A. suis, particularly the adhesins. Therefore, the objective of this study was to use bioinformatics tools to mine the newly annotated genome of a clinical isolate of A. suis [6] and identify adhesin-associated genes that may be involved in the early stages of pathogenesis of this organism. Adhesins play an important role in the pathogenesis of most bacteria by allowing them to attach to, colonise, and invade their hosts. In addition to host-pathogen interactions, adhesins are also critical in adherence to abiotic surfaces, auto-aggregation to other bacteria, and in the early stages of biofilm formation [79]. Adhesins are often classified as either fimbrial or afimbrial, where fimbrial adhesins are composed of multiple copies of one protein assembled into long appendages such as pili, and afimbrial adhesins are single proteins (e.g., autotransporters or outer membrane proteins) that have adhesive properties [10].

In the current study, we have identified proteins belonging to four different classes of adhesin-associated genes present in the A. suis genome (one fimbrial and three afimbrial) and provided a brief summary of their described roles in attachment in other members of the family Pasteurellaceae, with special emphasis on species in the genus Actinobacillus.

Results and discussion

Forty-seven putative adhesin-associated genes predicted to encode 24 adhesins were identified in the A. suis H91-0380 genome. These genes were categorised as autotransporter-encoding (Table 1), fimbriae-associated adhesins (Table 2), outer membrane proteins (OMPs; Table 3), and miscellaneous adhesins (Table 4).
Table 1

Putative autotransporter-encoding genes

ASU2 locus tag

GenInfo (GI) number

(Possible) gene name

GenBank Annotated protein function

Top App homologue/E value

Top Pasteurellaceae homologue/E value

Top other homologue/E value

ASU2_04675

407388580

a

Autotransporter adhesin

Ser. 10 str. D13039

2e−124

Actinobacillus capsulatus

0.0

Collimonas fungivorans Ter331

1e−54

ASU2_06645

407388974

a

autotransporter adhesin

Ser. 2 str. 4226

0.0

Actinobacillus capsulatus

0.0

Megasphaera genomosp. Type 1

2e−90

ASU2_07040

407389053

a

extracellular matrix protein adhesin A

Ser. 13 str. N273

5e−25

Actinobacillus capsulatus

0.0

Advenella mimigardefordensis DPN7

2e−14

ASU2_07665

407389178

ycgV (tibA) a,b

outer membrane autotransporter

Ser. 2 str. S1536

1.3

Actinobacillus capsulatus

0.0

Snodgrassella alvi wkB2

2e−37

ASU2_11100

407389854

aidA a,b,c

putative pertactin family virulence factor, OM autotransporter/Type V secretory pathway, adhesin

Ser. 7 str. AP76

1.2

Actinobacillus ureae

5E−132

Streptococcus suis R61

3e−11

ASU2_11275

407389889

a

autotransporter adhesin

Ser. 6 str. Femo

2e−58

Actinobacillus capsulatus

0.0

Acinetobacter sp. ANC 4105

5e−65

() indicates a suggested name that was not present in the annotation

aFunction assigned by conserved motifs

bIdentified by BASys

cClassified by description of homologues

Table 2

Putative fimbriae-associated genes

ASU2 locus tag

GenInfo (GI) number

(Possible) gene name

Annotated protein function

Top App homologue/E value

Top Pasteurellaceae homologue/E value

Top other homologue/E value

ASU2_00450

407387739

(pilF) c

Putative fimbrial biogenesis and twitching motility protein PilF-like protein

Ser. 3 str. JL03

2E−116

Actinobacillus capsulatus

4e−114

Vibrio nigripulchritudo

3e−28

ASU2_04295

407388504

flp1

flp operon protein

Ser. 4 str. M62

1e−24

Actinobacillus capsulatus

2E−27

Vibrio owensii

2e−05

ASU2_04300

407388505

(flp2) b

Hypothetical protein

Ser. 7 str. AP76

1e−16

Actinobacillus ureae

3E−24

Vibrio sp. HENC-02

4.3

ASU2_04305

407388506

(tadV) c

flp operon protein B; Flp pilus assembly protein, protease CpaA

Ser. 5b str. L20

9E−69

Actinobacillus capsulatus

6e−55

Yersinia rohdei ATCC 43380

5e−23

ASU2_04310

407388507

(rcpC)

flp operon protein C

Ser. 4 str. M62

3e−123

Actinobacillus capsulatus

3E−164

Yersinia similis

2e−19

ASU2_04315

407388508

(rcpA)

Rough colony protein A; flp pilus assembly protein, secretin CpaC

Ser. 7 str. AP76

0.0

Actinobacillus capsulatus

0.0

Yersinia similis

1e−101

ASU2_04320

407388509

rcpB

Rough colony protein B

Ser. 12 str. 1096

4e−84

Actinobacillus capsulatus

1E−102

Ochotona princeps

2.3

ASU2_04325

407388510

(tadZ) c

flp pilus assembly protein, ATPase; CpaE

Ser. 5b str. L20

0.0

Actinobacillus capsulatus

0.0

Yersinia bercovieri ATCC 43970

3e−58

ASU2_04330

407388511

tadA

Tight adherence protein A; Flp pilus assembly protein, ATPase CpaF

Ser. 5b str. L20

0.0

Actinobacillus capsulatus

0.0

Yersinia aldovae ATCC 35236

4e−179

ASU2_04335

407388512

tadB

Tight adherence protein B; Flp pilus assembly protein TadB

Ser. 1 str. 4074

0.0

Actinobacillus capsulatus

0.0

Serratia marcescens VGH107

5e−64

ASU2_04340

407388513

tadC

Tight adherence protein C; Flp pilus assembly protein TadC

Ser. 13 str. N-273

8e−160

Actinobacillus capsulatus

6E−164

Serratia marcescens VGH107

9e−36

ASU2_04345

407388514

tadD

Tight adherence protein D; Flp pilus assembly protein TadD, contains TPR repeats

Ser. 13 str. N-273

3e−129

Actinobacillus capsulatus

8E−148

Hafnia alvei ATCC 51873

7e−52

ASU2_04350

407388515

tadE

Tight adherence protein E

Ser. 10 str. D13039

2E−86

Actinobacillus capsulatus

3e−84

Serratia marcescens VGH107

2e−25

ASU2_04355

407388516

tadF

Tight adherence protein F

Ser. 6 str. Femo

2E−66

Actinobacillus capsulatus

1e−59

Yersinia enterocolitica

2e−12

ASU2_04360

407388517

tadG

Tight adherence protein G

Ser. 2 str. S1536

0.0

Mannheimia haemolytica

0.0

Yersinia frederiksenii ATCC 33641

6e−19

ASU2_05030

407388651

(pilD) c

Fimbrial leader peptidase; Type II secretory pathway, prepilin signal peptidase PulO and related peptidases

Ser. 1 str. 4074

3e−56

Actinobacillus ureae

1E−135

Enterococcus faecium EnGen0131

0.014

ASU2_05035

407388652

(pilC) c

Pili/fimbriae biogenesis protein; Type II secretory pathway, component PulF

Ser. 7 str. AP76

5e−112

Actinobacillus ureae

0.0

Glaciecola punicea DSM 14233

2e−29

ASU2_05040

407388653

(hofB, pilB) c

Fimbrial biogenesis protein; Type II secretory pathway, ATPase PulE/Tfp pilus assembly pathway, ATPase PilB

Ser. 5b str. L20

0.0

Actinobacillus ureae

0.0

Plesiomonas shigelloides 302-73

3e−117

ASU2_05045

407388654

apfA (ppdD, pilA) c

Type 4 prepilin subunit; Tfp pilus assembly protein, major pilin PilA

Ser. 12 str. 1096

5e−37

Actinobacillus ureae

1E−70

Bacillus sp. BVB01

5e−20

ASU2_06115

407388868

hofQ (comE) b,c

Type II secretory pathway, component HofQ

Ser. 5b str. L20

0.0

Actinobacillus ureae

0.0

Plesiomonas shigelloides 302-73

3e−100

ASU2_06120

407388869

(comD) b,c

Hypothetical protein; Ribosomal protein S15P/S13E

Ser. 5b str. L20

3e−59

Actinobacillus ureae

8.00E−60

Streptomyces sp. AA0539

0.049

ASU2_06125

407388870

(comC) b,c

Hypothetical protein

Ser. 7 str. AP76

9e−51

Actinobacillus capsulatus

4.00E−77

Klebsiella pneumoniae MGH 52

0.12

ASU2_06130

407388871

(comB) b,c

Hypothetical protein

Ser. 3 str. JL03

2e−65

Actinobacillus capsulatus

5e−95

Tepidiphilus margaritifer

0.49

ASU2_06135

407388872

(comA) b,c

Hypothetical protein

Ser. 10 str. D13039

7e−106

Actinobacillus capsulatus

4E−131

Desulfosarcina sp. BuS5

1.9

ASU2_11115

407389857

comF c

Competence

Ser. 10 str. D13039

9e−97

Actinobacillus capsulatus

7E−150

Serratia fonticola AU-AP2C

7e−47

() indicates a suggested name that was not present in the annotation

aFunction assigned by conserved motifs

bIdentified by BASys

cClassified by description of homologues

Table 3

Putative outer membrane protein genes

ASU2 locus tag

GenInfo (GI) number

(Possible) gene name

Annotated protein function

Top App homologue/E value

Top Pasteurellaceae homologue/E value

Top other homologue/E value

ASU2_00030

407387657

ompP2

Outer membrane protein P2; porin

Ser. 5b str. L20

0.0

Actinobacillus capsulatus

0.0

Neisseria sp. oral taxon 014 str. F0314

6e−131

ASU2_00525

407387754

ompP2

Outer membrane protein P2; porin

Ser. 4 str. M62

6e−42

Actinobacillus ureae

9E−159

Neisseria sp. oral taxon 014 str. F0314

4e−08

ASU2_01965

407388042

(ompP1) c

Long-chain fatty acid outer membrane transporter

Ser. 7 str. AP76

9e−142

Actinobacillus ureae

0.0

Serratia proteamaculans 568

4e−98

ASU2_02415

407388132

b,c

Hypothetical protein

Ser. 5b str. L20

3e−122

Actinobacillus ureae

2E−132

Pantoea sp. A4

6e−06

ASU2_03005

407388248

plp4

Lipoprotein; small protein A (tmRNA-binding)

Ser. 5b str. L20

0.0

Actinobacillus capsulatus

0.0

Pelistega sp. HM-7

8e−107

ASU2_03810

407388407

Outer membrane protein P2-like protein; porin

Ser. 3 str. JL03

0.0

Actinobacillus ureae

0.0

Neisseria sp. oral taxon 014

7e−27

ASU2_05520

407388749

palA

Outer membrane protein and related peptidoglycan-associated (lipo)proteins

Ser. 3 str. JL03

2E−89

Actinobacillus ureae

2E−89

Morganella morganii subsp. morganii KT

1e−46

ASU2_05735

407388792

ompW

Outer membrane protein

Ser. 5b str. L20

2e−68

Actinobacillus capsulatus

2E−119

Vibrio sp. Ex25

4e−42

ASU2_06455

407388936

b,c

Hypothetical protein

Ser. 7 str. AP76

2e−136

Actinobacillus ureae

2E−141

Taylorella equigenitalis ATCC 35865

2e−54

ASU2_09935

407389622

ompP5

Outer membrane protein P5

Ser. 3 str. JL03

0.0

Actinobacillus capsulatus

0.0

Shimwellia blattae DSM 4481

3e−69

ASU2_09940

407389623

(ompA) c

Major outer membrane protein

Ser. 6 str. Femo

0.0

Actinobacillus capsulatus

0.0

Salmonella enterica subsp. enterica ser. Typhimurium

2e−66

ASU2_11270

407389888

plp4

Outer membrane protein and related peptidoglycan-association (lipo)proteins

Ser. 4 str. M62

3e−35

Actinobacillus ureae

6E−85

Methylovorus glucosetrophus SIP3-4

4e−25

() indicates a suggested name that was not present in the annotation

aFunction assigned by conserved motifs

bIdentified by BASys

cClassified by description of homologues

Table 4

Miscellaneous other putative adhesin-associated genes

ASU2 locus tag

GenInfo (GI) number

(Possible) gene name

Annotated protein function

Top App homologue/E value

Top Pasteurellaceae homologue/E value

Top other homologue/E value

ASU2_06635

407388972

(fhaB) c

Filamentous haemagglutinin outer membrane protein

Ser. 6 str. Femo

0.0

Actinobacillus capsulatus

0.0

Acinetobacter bohemicus

0.0

ASU2_06640

407388973

(fhaC) c

Hemolysin activation/secretion protein

Ser. 4 str. M62

0.0

Actinobacillus capsulatus

0.0

Ralstonia solanacearum

1e−168

ASU2_09130

407389463

(ftpA, dps) c

Fine tangled pili major subunit; DNA-binding ferritin-like protein (oxidative damage protectant); DNA protection during starvation

Ser. 3 str. JL03

2e−119

Actinobacillus ureae

2E−130

Jonesia denitrificans DSM 20603

2e−61

ASU2_10345

407389704

(comE1, comEA, ybaV) c

DNA uptake protein; DNA uptake protein and related DNA-binding proteins; transporter

Ser. 7 str. AP76

6e−34

Actinobacillus capsulatus

1E−75

Vibrio nigripulchritudo

4e−21

() indicates a suggested name that was not present in the annotation

aFunction assigned by conserved motifs

bIdentified by BASys

cClassified by description of homologues

Autotransporters

Six autotransporter-encoding genes were identified in the A. suis genome (Table 1). Among these, 4 encode proteins that belong to the subfamily known as trimeric autotransporter adhesins (TAAs). Autotransporters are large proteins with three domains—an N-terminal signal domain (present in the immature form of the protein, cleaved from the mature protein), a passenger domain, and a C-terminal translocator domain. In the case of TAAs, the translocator domain is short, and the adhesin structure is formed by a homotrimerisation of the encoded protein [11]. Examples of classic TAAs include Hia in Haemophilus influenzae [12] and YadA in Yersinia enterocolitica [13, 14], and they are characterised by a conserved YadA domain and resistance to proteolytic degradation. All TAAs described to date have adhesive properties and bind to different host components including epithelial cells, extracellular matrix components, and circulating molecules (e.g., complement inhibitory proteins, immunoglobulins) [11].

The four genes encoding TAAs identified in the A. suis genome, ASU2_04675, ASU2_06645, ASU2_07040, and ASU2_11275, are all well conserved in A. capsulatus (E value = 0.0). They also have homologues in A. pleuropneumoniae (E values = 0.0–5e−25), but the top homologues are found in different serovars. These TAAs also share homology with genes in distant species (E values ranging from 2e−14 to 2e−90). Given that many of the distant species (e.g., Collimonas, Megasphaera, Advenella, Acinetobacter spp.) with homologues of the A. suis-encoded TAAs are environmental isolates, this may hint that these TAAs are well conserved throughout evolution.

The other two autotransporter genes identified in the A. suis genome encode putative conventional autotransporters. These proteins have the same domains as TAAs, but have a longer translocator domain. In addition to being adhesins that play important roles in attachment and biofilm formation, these autotransporters can have additional properties such as cytotoxic, proteolytic or lipolytic activity, and may play a role in serum resistance [11]. In the A. suis genome, the putative conventional autotransporter-encoding genes, ASU2_07665 and ASU2_11100, are annotated as ycgV and aidA, respectively. While the ycgV gene is well conserved in A. capsulatus (E-value = 0.0) and aidA is quite well conserved in A. ureae (E value = 5e−132), there were no close homologues in A. pleuropneumoniae. It is also noteworthy that in a search for motifs in aidA done using Pfam, no conserved motifs, including the hallmark domains of conventional autotransporters, were detected. Therefore, the classification as an autotransporter-encoding gene relied solely on homology to other autotransporter-encoding genes in GenBank and annotation by BASys. The top homologue of aidA identified in species outside the family Pasteurellaceae was in the Gram positive bacterium Streptococcus suis. However, almost all aidA homologues in Streptococcus species are annotated as hypothetical proteins (with the exception of one homologue which is annotated as the LPXTG-motif cell wall anchor domain protein), and the E value (3e−11), coverage (53 %), and identity (31 %) of the top Streptococcus suis homologue suggest that the degree of conservation of this gene is low. The homology of the A. suis aidA gene with species such as streptococci that share a common environment in the upper respiratory tract of swine may hint at convergent evolution or horizontal gene transfer, but further studies would have to be done to rigorously test such assertions.

Fimbriae-associated adhesins

Twenty-five putative fimbriae-associated adhesin genes were also identified (Table 2). These included 14 genes predicted to be part of a tight adherence (tad) locus, a type IV pilus operon (4 genes), another type IV pilus biogenesis locus containing 6 genes, and another pilus-associated gene.

The pilF gene (ASU2_00450) annotated as a putative fimbrial biogenesis and twitching motility protein, is well conserved in Pasteurellaceae. It is less well conserved outside the family, but pilF homologues are present in Pseudomonas aeruginosa and in Neisseria meningitis (pilW) and are thought to encode a protein that is critical for pilus stability and function, including attachment to human cells [15, 16]. Pfam analysis revealed TPR repeats in the A. suis pilF gene. In other species, these repeats are thought to play a role in protein–protein interactions in both prokaryotic and eukaryotic cells, and contribute to virulence of bacterial pathogens by aiding in attachment to and invasion of host cells and circumventing host defences [17].

The tad locus is a conserved widespread colonisation island [18] that plays an important role in pathogenesis, biofilm formation, and colonisation of several organisms, including members of the family Pasteurellaceae [1922]. The tad locus encodes the machinery needed to assemble the fimbrial low-molecular-weight protein (Flp) pilin into long, bundled type IVb pili [21, 22]. The A. suis genome contains a tad locus comprised of homologues of flp1-flp2-tadV-rcpC-rcpA-rcpB-tadZ-tadA-tadB-tadC-tadD-tadE-tadF-tadG. The two putative pilin genes, ASU2_04295 and ASU2_04300, are predicted to encode flp1 and flp2, respectively; however, it may be noted that flp2 is not expressed in Aggregatibacter actinomycetemcomitans [22]. Neither of these genes is very highly conserved within the family Pasteurellaceae and is even less so in more distant species. This may reflect the fact that the flp1 and flp2 putative pilin genes in A. suis have adapted for colonisation of different hosts or different host cell receptors. A genetic analysis of the tad locus by Li et al. [23] revealed that flp1 is truncated or missing altogether in some strains of A. pleuropneumoniae. In the same study, these authors found that tadC is the best conserved among A. pleuropneumoniae strains tested and tadG the least, findings that were not observed in this work when the same genes in the A. suis genome were compared to other species. However, many of the biogenesis components of the tad locus of A. suis are well conserved in A. pleuropneumoniae and other members of the family Pasteurellaceae such as A. capsulatus, and much less well conserved outside the family.

In addition to the tad locus, the A. suis genome also has two other loci for type IV pilus biogenesis: a type IV pilus locus (pilABCD/apfABCD) and a homologue of the comABCDEF locus. Type IV pili are important virulence factors in many Gram negative organisms, including other members of the family Pasteurellaceae such as nontypeable Haemophilus influenzae (NTHi) [2427], Pasteurella multocida [28], and A. pleuropneumoniae [2931]. In these species, type IV pili have demonstrated roles in biofilm formation, attachment to epithelial cells, twitching motility, competence, and interactions with phage [3234]. In A. pleuropneumoniae, the apfA pilin gene is present in all strains and is well conserved in all serovars [31]. The homologue of this gene in A. suis (ASU2_05045) is the least well conserved gene in the pilABCD locus, but is still homologous to genes in both A. ureae (1e-70) and A. pleuropneumoniae (5e-37). Of the biogenesis genes, pilBCD, pilB, which encodes the ATPase, is the best conserved (E values = 0.0), and has well conserved homologues outside the family Pasteurellaceae (e.g., in Plesiomonas shigelloides, E value = 5e−20). On the other hand, the pilD gene, predicted to encode the fimbrial leader peptidase, is not conserved in species outside the family Pasteurellaceae (e.g., Enterococcus faecium, E value = 0.014).

Like pilABCD/apfABCD, the comABCDEF competence locus is predicted to encode the biogenesis components for type IV pilus assembly; however, no pilin gene is associated with this operon in the A. suis genome, and the comF gene (ASU2_11115) is not linked with the rest of the com locus, unlike other species such as NTHi [24]. In a recent study of NTHi, Carruthers et al. found that all of the products of both the pil and com operons, including comF, are essential for proper type IV pilus construction and formation [24]. Taken together, these results suggest that the proteins encoded by the pil and com loci may work together to produce type IV pili in A. suis, and that the pilA homologue (ASU2_05045) may encode the major pilin protein.

Outer membrane proteins

Genes predicted to encode twelve outer membrane proteins (OMPs) were identified, including homologues of ompA, ompP2, and ompP5 porin genes (Table 3). OMPs are described as multifunctional proteins. Many OMPs have been demonstrated to form porins in the outer membrane of Gram negative bacteria, which can contribute to nutrient acquisition, antibiotic resistance, attachment, invasion, and complement resistance, to name a few [35].

Most of the OMPs of A. suis are highly conserved when compared to other members of the family Pasteurellaceae. Two members of the OmpA family were identified in the A. suis genome, ASU2_09940 and ASU2_09935. In our previous studies, the OmpA homologue ASU2_09940 was identified by signature-tagged mutagenesis as an important virulence factor of A. suis, with a demonstrated role in attachment to swine tonsil explants and to porcine brain microvascular endothelial cells [36, 37]. The other member of the OmpA family of OMPs, an ompP5 homologue (ASU2_09935), is adjacent to the ompA homologue ASU2_09940 in the A. suis genome. It is also highly conserved (E value = 0.0) in members of the family Pasteurellaceae and has a high degree of homology with OMPs outside the family. In NTHi, OmpP5 has been shown to bind to human mucin [38] and to CEACAM1 [39]; however, the precise role of OmpP5 and most other A. suis OMPs in pathogenesis remains to be demonstrated.

Two ompP2 genes (ASU2_00030 and ASU2_00525) and one ompP2-like gene (ASU2_03810) were identified in the A. suis genome. In addition to conferring antibiotic resistance [40], providing a pore for general diffusion and transport of specific substrates [41], the OmpP2 of NTHi has also been shown to play a role in attachment in the host environment through interactions with mucin [42]. The ompP2 gene (ASU2_00030) is predicted to encode a protein that is very similar to an OmpP2 homologue in A. capsulatus (E = 0.0) while the ASU2_00525 gene encodes a protein that is well conserved in A. ureae (9E−159). The ompP2 homologues identified in A. suis are well conserved in A. pleuropneumoniae, but the serovar of the top homologues in A. pleuropneumoniae is different with each gene, as is the degree of conservation. Of the OMPs identified in A. suis, the ompP2 gene ASU2_00525 and the plp4 homologue ASU2_02415 have the least homology with proteins encoded by organisms outside of the family Pasteurellaceae. The GC content of ASU2_00525 differs markedly from that of the A. suis genome (36 vs. 40.24 %), which may suggest that this ompP2 gene was recently acquired by A. suis.

Because of the multifunctional nature of the OMPs, it would be premature to predict that all OMPs identified in this study play a role in attachment or invasion, and further studies should be done to characterise each gene and its potential role in bacterial pathogenesis for A. suis.

Miscellaneous adhesins

Four additional genes from three different loci were identified that could play a role in bacterial attachment, colonisation, or invasion for A. suis (Table 4).

A filamentous haemagglutinin (FHA) locus consisting of two genes (ASU2_06635 and ASU2_06640) is also found in the A. suis genome. The fhaB gene encodes the adhesin structure while fhaC encodes the transporter. FHA has been demonstrated to play a role in bacterial attachment to integrins, carbohydrates present on macrophages, cilia, epithelial cells, and extracellular matrix components including heparin [43], and is thought to contribute to colonisation and biofilm formation by important pathogens such as Histophilus somni, Bordetella bronchiseptica, Acinetobacter baumannii, and Pasteurella multocida [4447]. The A. suis fhaB gene has highly conserved (E values = 0.0) homologues in A. pleuropneumoniae, Pasteurellaceae, and in other species outside of the family Pasteurellaceae. The fhaC gene is also predicted to encode highly conserved homologues in members of the family Pasteurellaceae but to a slightly lower degree (E value = 1e−168). It is also interesting to note that the TAA-encoding ASU2_06645 gene is linked to the filamentous haemagglutinin locus, though the relevance of this finding, if any, remains to be elucidated.

A fine-tangled pili gene, ftpA, is also present in the A. suis genome. This gene lacks a cleavable signal sequence [48], and no biogenesis genes for the translocation and assembly of this structure were identified. In other species, fine-tangled pili are assigned to the DNA protection during starvation (DPS) family of proteins. DPS proteins are thought to confer protection of DNA from environmental stressors such as low pH, Fe2+, and hydrogen peroxide [49]. Further, these proteins have been shown to be involved in bacterial adhesion to and invasion of host cells, and in auto-aggregation [4953], though it is not clear whether the mechanisms of these actions are via a direct or indirect adhesive function of the Dps homologue. In A. suis, the ftpA gene (ASU2_09130) is well conserved in both A. pleuropneumoniae (E value = 2e−119) and other members of Pasteurellaceae (A. ureae, E value = 2e−130), and to a lesser extent in other species (Jonesia denitrificans, E value = 2e−61).

Finally, a homologue of comE1, originally described in Pasteurella multocida [54], was also identified in A. suis. In addition to its roles in DNA-binding and uptake, this gene encodes a protein involved in bacterial attachment of five different members of the family Pasteurellaceae to the extracellular matrix component fibronectin [55, 56]. The closest homologue of the comE1 gene in A. suis (ASU2_10345) is found in A. capsulatus (E value = 1e−75). Less well conserved homologues are also present in A. pleuropneumoniae (E value = 6e−34), other members of Pasteurellaceae, and even in other species outside the family. Given the role of this gene in fibronectin-binding in other members of Pasteurellaceae, it would be interesting to assess whether it plays a similar function in A. suis.

Adhesins in other A. suis strains

To determine whether putative adhesin genes are conserved in other A. suis isolates, real-time PCR was done on 9 additional isolates, including A. pleuropneumoniae L20, a serovar 5b isolate (Table 5). Ten genes were chosen for characterisation, with representatives from each of the classes of adhesins described. All A. suis isolates tested were positive for the selected adhesin genes, while the A. pleuropneumoniae isolate was only positive for the putative ompP2 gene. Upon closer inspection of the A. pleuropneumoniae L20 genome sequence, the only adhesin gene tested without a homologue was ycgV (ASU2_07665); however, despite there being homologues of the other genes, the sequence conservation in the primer binding sites in all but the ompP2 gene was poor.
Table 5

Real-time PCR detection of selected putative adhesin genes with A. suis H91-0380 primers

Isolate

YcgV (ASU2_07665)

Flp1 (ASU2_04295)

TadG (ASU2_04360)

PilA (ASU2_05045)

OmpP2 (ASU2_00030)

OmpA (ASU2_09940)

Plp4 (ASU2_11270)

FhaB (ASU2_06635)

FtpA (ASU2_09130)

ComE1 (ASU2_10345)

H91-0380

+

+

+

+

+

+

+

+

+

+

ATCC 15557

+

+

+

+

+

+

+

+

+

+

H89-1173

+

+

+

+

+

+

+

+

+

+

H91-0406

+

+

+

+

+

+

+

+

+

+

SO4 Nalr

+

+

+

+

+

+

+

+

+

+

VSB 3714

+

+

+

+

+

+

+

+

+

+

C84

+

+

+

+

+

+

+

+

+

+

Q95-6256

+

+

+

+

+

+

+

+

+

+

H93-1250

+

+

+

+

+

+

+

+

+

+

App L20

+

+, indicates detection of a gene in a specific isolate

−, indicates no detection of a gene in a specific isolate

The pseudogenomes of three additional A. suis genomes—ATCC 15557, H89-0406, and H91-1173—were annotated using BASys, and the genome sequence of ATCC 33416T was obtained from GenBank [57]. These four genome sequences were used to determine whether putative adhesin genes were conserved in different A. suis isolates using blastn for direct nucleotide sequence comparisons (Additional file 1). Homologues of all adhesin genes identified in the A. suis H91-0380 genome were found in the four additional genomes, and were for the most part highly conserved (most >99 % sequence identity). Some gene lengths varied among isolates, with the most notable differences seen in the ASU2_04675 autotransporter-encoding homologue found in ATCC 33415 and ATCC 15557, the ASU2_11275 autotransporter-encoding homologue in ATCC 15557, and the truncated but highly conserved flp1 (ASU2_04295) homologue in H89-1173. The OMP homologue ASU2_01965 in the ATCC 33415 isolate shared only 67 % nucleotide identity with H91-0380, despite 90 % sequence coverage. Overall, however, putative adhesin genes were highly conserved in all A. suis isolates examined, which may suggest a clonal population, though other classes of genes, particularly virulence-associated genes, should also be compared.

Conclusions

Attachment and colonisation of the host environment are important steps in the early stages of bacterial colonisation and pathogenesis [7]. As virtually nothing was known about these early steps in A. suis, the purpose of this study was to identify putative adhesins that may contribute to these processes in the genomes of several A. suis strains. Our analysis revealed that A. suis shares many of the same putative adhesins as A. pleuropneumoniae, an important primary pathogen of swine that is also known to colonise the upper respiratory tract. It may therefore be hypothesised that the different tissue tropisms and diseases caused by A. suis and A. pleuropneumoniae might be attributed, at least in part, to subtle differences in the adhesins of these organisms or to differential expression of adhesins at different stages of the infection process.

The adhesins identified in the A. suis genome are also well conserved in several other members of the family Pasteurellaceae. It is perhaps noteworthy that Pasteurellaceae that cause similar diseases but in different hosts, such as A. ureae and A. capsulatus, have nearly all the same adhesins as are present in A. suis. Of particular note are the autotransporter-encoding genes ycgV and aidA that are present in A. suis, A. ureae, and A. capsulatus, but which are missing in A. pleuropneumoniae. It may be hypothesised that these organisms employ similar strategies to invade the host, but more work is needed to characterise such host-pathogen interactions.

Together, these data begin to identify attachment and colonisation factors that may allow some members of the family Pasteurellaceae to invade the bloodstream and others to cause more localised infections. Future research on the expression of adhesins in A. suis and other organisms will help in elucidating the mechanisms of attachment and colonisation, and should eventually lead to a better understanding of critical host-pathogen relationships.

Methods

Bioinformatics

To identify putative adhesin-associated genes in Actinobacillus suis H91-0380, a virulent O2:K2 isolate [6], a manual search of the annotations of the A. suis H91-0380 genome assigned by the BASys pipeline [58] and GenBank (http://www.ncbi.nlm.nih.gov/) was done to identify putative adhesin-associated genes; blastx was used to find homologues in other species with a described or annotated role in attachment, colonisation, or invasion. Genes or proteins described in the literature in other members of the family Pasteurellaceae were also analysed by blastx or blastp to find homologues in A. suis.

Further analysis of selected putative adhesin-associated genes was done using Pfam (http://pfam.xfam.org/) to determine if conserved amino acid motifs characteristic of described protein families were present. When motifs were not identified, sequence identity and query coverage alone were used to classify genes.

Bacterial strains and growth media

Bacterial isolates (Table 6) were cultured from glycerol stocks onto Columbia agar plates containing 5 % sheep’s blood (Oxoid Co., Nepean, ON, USA), and in the case of the A. pleuropneumoniae isolate, supplemented with 0.01 % (wt/vol) nicotinamide adenine dinucleotide (Sigma-Aldrich, St. Louis, MO). Plates were incubated overnight at 37 °C in an atmosphere of 5 % CO2.
Table 6

Strains used in this study

Bacterial strain

Characteristic(s)

GenBank accession number and Reference

Actinobacillus suis H91-0380

O2:K2 clinical isolate

CP003875; [6, 61]

Actinobacillus suis ATCC 33415

Untyped clinical isolate

CP009159; [57]

Actinobacillus suis ATCC 15557

O1:K1 isolate

[61, 62]

Actinobacillus suis H89-1173

O2:K3 clinical isolate

[61, 62]

Actinobacillus suis H91-0406

O2:K3 clinical isolate

[61, 62]

Actinobacillus suis SO4 Nalr

O1:K1 isolate

[61, 62]

Actinobacillus suis VSB 3714

Rough:K? isolate

[61, 62]

Actinobacillus suis C84

O1:K2 isolate

[61, 62]

Actinobacillus suis Q95-6256

Untypable isolate

[61, 62]

Actinobacillus suis H93-1250

Untyped clinical isolate

[61, 62]

Actinobacillus pleuropneumoniae L20

Serovar 5b

[63]

Real-time PCR

Crude genomic DNA was prepared by picking isolated colonies and dispersing them in Instagene matrix (Bio-Rad Laboratories Ltd., Hercules, CA), mixing by vortex, incubating at 56 °C for 30 min, mixing again by vortex, incubating at 100 °C for 8 min, centrifuging at 5000×g for 2 min, and using the supernatant as template for PCR. At least two biological replicates were done for each strain and gene tested.

PCR primers were designed using Primer3 as previously described [59], and are listed in Table 7. The total reaction volume was 20 µL, which contained 10 µL LightCycler 480 SYBR Green I Master mix (Roche Diagnostics Co., Indianapolis, IN, USA), 0.4 µL each of the forward and reverse primers to a final concentration of 1 µM, 4.2 µL nuclease-free water, and 5 µL template.
Table 7

Primers used in this work

Primer name

Class

Locus tag

Sequence

Source

ASU2-ycgV-F1

Autotransporter

ASU2_07665

CTGGGATGTTCCTGTTGTTGCT

This work

ASU2-ycgV-R1

TTTACCGAGGTTTATCGTACTGTTTGT

This work

ASU2-flp1-F1

Fimbriae-associated

ASU2_04295

CTGTAACTGAAGGTATCCGCAACT

This work

ASU2-flp1-R1

TGCTAAAGCCACAGCAATTAAACC

This work

ASU2-tadG-F1

Fimbriae-associated

ASU2_04360

ACTGAATGACGACAAGAATACATCG

This work

ASU2-tadG-R1

GCAGAGTAGTAGTTTCCATCACCT

This work

ASU2-pilA-F1

Fimbriae-associated

ASU2_05045

ACTGTTAGCGGCATCTTCTGC

This work

ASU2-pilA-R1

CTACGCTGCCCTTGCCATTC

This work

ASU2-ompP2-F1

OMP

ASU2_00030

ACCTCAGCCAAAGACACTTACCAAA

This work

ASU2-ompP2-R1

TAAACGCCATTCTACACGGCCTAAA

This work

ASU2-ompA-F1

OMP

ASU2_09940

CGGTAAAGTAGGTGTTGCAGTT

This work

ASU2-ompA-R1

ATTTCTCTGTTGGTTCGTTAGTGT

This work

ASU2-plp4-F1

OMP

ASU2_11270

GTCGAATCTAACTGCGAAGGGTAAAG

This work

ASU2-plp4-R1

GTTGTATGCAGGAGAACCTAAACGG

This work

ASU2-fhaB-F1

Miscellaneous

ASU2_06635

GGATTTAGCCGTACATGGAAATGG

This work

ASU2-fhaB-R1

ATACTTTACCTTTGATTTGAGCCGT

This work

ASU2-ftpA-F1

Miscellaneous

ASU2_09130

CGGAGCGTATGGCAGCATTAG

This work

ASU2-ftpA-R1

GGATATTCAGGCGTTTGACGTGTT

This work

ASU2-comE1-F1

Miscellaneous

ASU2_10345

GTCACAGAACCCACTCCCGT

This work

ASU2-comE1-R1

TTTATCTTGGATTTCCGCTGCTGTT

This work

Real-time PCR was done in a LightCycler 480 (Roche Diagnostics Co., Indianapolis, IN) using a program with an initial denaturation of 95 °C for 5 min followed by 45 cycles of 95 °C for 10 s, 54 °C for 20 s, and 72 °C for 12 s. Stepwise melt curves were done at the end of each run to confirm that only one template was amplified.

Sequencing additional isolates

A. suis strains ATCC 15557, H89-1173, and H91-0406 were sequenced at the Advanced Analytics Centre at the University of Guelph using MiSeq, and pseudogenomes were assembled with SeqMan Pro (DNASTAR Inc., Madison, WI, USA) followed by progressiveMauve [60], and annotated using the BASys pipeline [58].

Declarations

Authors’ contributions

ARB designed and carried out data collection and analysis, and drafted the manuscript. JIM assisted in experimental design. Both authors read and approved the final manuscript.

Acknowledgements

The authors thank Glenn Soltes for assistance with Real-time PCR experiments, and Andrew Shure and Dr. Andrew Kropinski for providing pseudogenomes. This work was funded by a grant from the Natural Sciences and Engineering Research Council of Canada to JIM. ARB is supported by an Ontario Veterinary College PhD Scholarship and an Ontario Graduate Scholarship.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Pathobiology, Ontario Veterinary College, University of Guelph, Ontario, Canada

References

  1. Kernaghan S, Bujold AR, MacInnes JI. The microbiome of the soft palate of swine. Anim Health Res Rev. 2012;13:110–20.View ArticlePubMedGoogle Scholar
  2. MacInnes JI, Desrosiers R. Agents of the “suis-ide diseases” of swine: actinobacillus suis, Haemophilus parasuis, and Streptococcus suis. Can J Vet Res. 1999;63:83–9.PubMed CentralPubMedGoogle Scholar
  3. Bosse JT, Janson H, Sheehan BJ, Beddek AJ, Rycroft AN, Kroll JS, Langford PR. Actinobacillus pleuropneumoniae: pathobiology and pathogenesis of infection. Microb Infect. 2002;4:225–35.View ArticleGoogle Scholar
  4. MacInnes JI. Actinobacillus. In: Gyles CL, Prescott JF, Songer G, Thoen CO, editors. Pathogenesis of bacterial infections in animals. 4th ed. Ames: Wiley-Blackwell; 2010. p. 363–86.View ArticleGoogle Scholar
  5. Jeannotte ME, Slavic D, Frey J, Kuhnert P, MacInnes JI. Analysis of non-porcine isolates of Actinobacillus suis. Vet Microbiol. 2002;85:83–93.View ArticlePubMedGoogle Scholar
  6. MacInnes JI, Mackinnon J, Bujold AR, Ziebell K, Kropinski AM, Nash JH. Complete genome sequence of Actinobacillus suis H91-0380, a virulent serotype O2 strain. J Bacteriol. 2012;194:6686–7.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Ofek I, Doyle RJ. Bacterial adhesion to cells and tissues. New York: Chapman & Hall; 1994.View ArticleGoogle Scholar
  8. Soto GE, Hultgren SJ. Bacterial adhesins: common themes and variations in architecture and assembly. J Bacteriol. 1999;181:1059–71.PubMed CentralPubMedGoogle Scholar
  9. Klemm P, Schembri MA. Bacterial adhesins: function and structure. Int J Med Microbiol. 2000;290:27–35.View ArticlePubMedGoogle Scholar
  10. Linke D, Goldman A. Bacterial adhesion: chemistry, biology and physics. Dordrecht: Springer; 2011.View ArticleGoogle Scholar
  11. Cotter SE, Surana NK, St Geme JW 3rd. Trimeric autotransporters: a distinct subfamily of autotransporter proteins. Trends Microbiol. 2005;13:199–205.View ArticlePubMedGoogle Scholar
  12. Surana NK, Cutter D, Barenkamp SJ, St Geme JW 3rd. The Haemophilus influenzae Hia autotransporter contains an unusually short trimeric translocator domain. J Biol Chem. 2004;279:14679–85.View ArticlePubMedGoogle Scholar
  13. Hoiczyk E, Roggenkamp A, Reichenbecher M, Lupas A, Heesemann J. Structure and sequence analysis of Yersinia YadA and Moraxella UspAs reveal a novel class of adhesins. EMBO J. 2000;19:5989–99.PubMed CentralView ArticlePubMedGoogle Scholar
  14. Roggenkamp A, Ackermann N, Jacobi CA, Truelzsch K, Hoffmann H, Heesemann J. Molecular analysis of transport and oligomerization of the Yersinia enterocolitica adhesin YadA. J Bacteriol. 2003;185:3735–44.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Watson AA, Alm RA, Mattick JS. Identification of a gene, pilF, required for type 4 fimbrial biogenesis and twitching motility in Pseudomonas aeruginosa. Gene. 1996;180:49–56.View ArticlePubMedGoogle Scholar
  16. Carbonnelle E, Helaine S, Prouvensier L, Nassif X, Pelicic V. Type IV pilus biogenesis in Neisseria meningitidis: PilW is involved in a step occurring after pilus assembly, essential for fibre stability and function. Mol Microbiol. 2005;55:54–64.View ArticlePubMedGoogle Scholar
  17. Cerveny L, Straskova A, Dankova V, Hartlova A, Ceckova M, Staud F, Stulik J. Tetratricopeptide repeat motifs in the world of bacterial pathogens: role in virulence mechanisms. Infect Immun. 2013;81:629–35.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Planet PJ, Kachlany SC, Fine DH, DeSalle R, Figurski DH. The widespread colonization island of Actinobacillus actinomycetemcomitans. Nat Genet. 2003;34:193–8.View ArticlePubMedGoogle Scholar
  19. Spinola SM, Fortney KR, Katz BP, Latimer JL, Mock JR, Vakevainen M, Hansen EJ. Haemophilus ducreyi requires an intact flp gene cluster for virulence in humans. Infect Immun. 2003;71:7178–82.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Fuller TE, Kennedy MJ, Lowery DE. Identification of Pasteurella multocida virulence genes in a septicemic mouse model using signature-tagged mutagenesis. Microb Pathog. 2000;29:25–38.View ArticlePubMedGoogle Scholar
  21. Tomich M, Fine DH, Figurski DH. The TadV protein of Actinobacillus actinomycetemcomitans is a novel aspartic acid prepilin peptidase required for maturation of the Flp1 pilin and TadE and TadF pseudopilins. J Bacteriol. 2006;188:6899–914.PubMed CentralView ArticlePubMedGoogle Scholar
  22. Tomich M, Planet PJ, Figurski DH. The tad locus: postcards from the widespread colonization island. Nat Rev Microbiol. 2007;5:363–75.View ArticlePubMedGoogle Scholar
  23. Li T, Xu Z, Zhang T, Li L, Chen H, Zhou R. The genetic analysis of the flp locus of Actinobacillus pleuropneumoniae. Arch Microbiol. 2012;194:167–76.View ArticlePubMedGoogle Scholar
  24. Carruthers MD, Tracy EN, Dickson AC, Ganser KB, Munson RS Jr, Bakaletz LO. Biological roles of nontypeable Haemophilus influenzae type IV pilus proteins encoded by the pil and com operons. J Bacteriol. 2012;194:1927–33.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Bakaletz LO, Baker BD, Jurcisek JA, Harrison A, Novotny LA, Bookwalter JE, Mungur R, Munson RS Jr. Demonstration of Type IV pilus expression and a twitching phenotype by Haemophilus influenzae. Infect Immun. 2005;73:1635–43.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Jurcisek JA, Bakaletz LO. Biofilms formed by nontypeable Haemophilus influenzae in vivo contain both double-stranded DNA and type IV pilin protein. J Bacteriol. 2007;189:3868–75.PubMed CentralView ArticlePubMedGoogle Scholar
  27. Jurcisek JA, Bookwalter JE, Baker BD, Fernandez S, Novotny LA, Munson RS Jr, Bakaletz LO. The PilA protein of non-typeable Haemophilus influenzae plays a role in biofilm formation, adherence to epithelial cells and colonization of the mammalian upper respiratory tract. Mol Microbiol. 2007;65:1288–99.View ArticlePubMedGoogle Scholar
  28. Hunt ML, Adler B, Townsend KM. The molecular biology of Pasteurella multocida. Vet Microbiol. 2000;72:3–25.View ArticlePubMedGoogle Scholar
  29. Boekema BK, Stockhofe-Zurwieden N, Smith HE, Kamp EM, van Putten JP, Verheijden JH. Adherence of Actinobacillus pleuropneumoniae to primary cultures of porcine lung epithelial cells. Vet Microbiol. 2003;93:133–44.View ArticlePubMedGoogle Scholar
  30. Boekema BK, Van Putten JP, Stockhofe-Zurwieden N, Smith HE. Host cell contact-induced transcription of the type IV fimbria gene cluster of Actinobacillus pleuropneumoniae. Infect Immun. 2004;72:691–700.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Zhou Y, Li L, Chen Z, Yuan H, Chen H, Zhou R. Adhesion protein ApfA of Actinobacillus pleuropneumoniae is required for pathogenesis and is a potential target for vaccine development. Clin Vaccine Immunol. 2013;20:287–94.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Wall D, Kaiser D. Type IV pili and cell motility. Mol Microbiol. 1999;32:1–10.View ArticlePubMedGoogle Scholar
  33. Craig L, Pique ME, Tainer JA. Type IV pilus structure and bacterial pathogenicity. Nat Rev Microbiol. 2004;2:363–78.View ArticlePubMedGoogle Scholar
  34. Hansen JK, Forest KT. Type IV pilin structures: insights on shared architecture, fiber assembly, receptor binding and type II secretion. J Mol Microbiol Biotechnol. 2006;11:192–207.View ArticlePubMedGoogle Scholar
  35. Galdiero S, Falanga A, Cantisani M, Tarallo R, Della Pepa ME, D’Oriano V, Galdiero M. Microbe-host interactions: Structure and role of Gram-negative bacterial porins. Curr Protein Peptide Sci. 2012;13:843–54.View ArticleGoogle Scholar
  36. Ojha S, Lacouture S, Gottschalk M, MacInnes JI. Characterization of colonization-deficient mutants of Actinobacillus suis. Vet Microbiol. 2010;140:122–30.View ArticlePubMedGoogle Scholar
  37. Ojha S, Sirois M, Macinnes JI. Identification of Actinobacillus suis genes essential for the colonization of the upper respiratory tract of swine. Infect Immun. 2005;73:7032–9.PubMed CentralView ArticlePubMedGoogle Scholar
  38. Novotny LA, Jurcisek JA, Pichichero ME, Bakaletz LO. Epitope mapping of the outer membrane protein P5-homologous fimbrin adhesin of nontypeable Haemophilus influenzae. Infect Immun. 2000;68:2119–28.PubMed CentralView ArticlePubMedGoogle Scholar
  39. Hill DJ, Toleman MA, Evans DJ, Villullas S, Van Alphen L, Virji M. The variable P5 proteins of typeable and non-typeable Haemophilus influenzae target human CEACAM1. Mol Microbiol. 2001;39:850–62.View ArticlePubMedGoogle Scholar
  40. Regelink AG, Dahan D, Moller LV, Coulton JW, Eijk P, Van Ulsen P, Dankert J, Van Alphen L. Variation in the composition and pore function of major outer membrane pore protein P2 of Haemophilus influenzae from cystic fibrosis patients. Antimicrob Agents Chemother. 1999;43:226–32.PubMed CentralPubMedGoogle Scholar
  41. Andersen C, Maier E, Kemmer G, Blass J, Hilpert AK, Benz R, Reidl J. Porin OmpP2 of Haemophilus influenzae shows specificity for nicotinamide-derived nucleotide substrates. J Biol Chem. 2003;278:24269–76.View ArticlePubMedGoogle Scholar
  42. Reddy MS, Bernstein JM, Murphy TF, Faden HS. Binding between outer membrane proteins of nontypeable Haemophilus influenzae and human nasopharyngeal mucin. Infect Immun. 1996;64:1477–9.PubMed CentralPubMedGoogle Scholar
  43. Locht C, Antoine R, Jacob-Dubuisson F. Bordetella pertussis, molecular pathogenesis under multiple aspects. Curr Opin Microbiol. 2001;4:82–9.View ArticlePubMedGoogle Scholar
  44. Nicholson TL, Brockmeier SL, Loving CL. Contribution of Bordetella bronchiseptica filamentous hemagglutinin and pertactin to respiratory disease in swine. Infect Immun. 2009;77:2136–46.PubMed CentralView ArticlePubMedGoogle Scholar
  45. Sandal I, Shao JQ, Annadata S, Apicella MA, Boye M, Jensen TK, Saunders GK, Inzana TJ. Histophilus somni biofilm formation in cardiopulmonary tissue of the bovine host following respiratory challenge. Microbes Infect. 2009;11:254–63.View ArticlePubMedGoogle Scholar
  46. Darvish Alipour Astaneh S, Rasooli I, Mousavi Gargari SL. The role of filamentous hemagglutinin adhesin in adherence and biofilm formation in Acinetobacter baumannii ATCC19606. Microb Pathog. 2014;74C:42–9.View ArticleGoogle Scholar
  47. Verma S, Sharma M, Katoch S, Verma L, Kumar S, Dogra V, Chahota R, Dhar P, Singh G. Profiling of virulence associated genes of Pasteurella multocida isolated from cattle. Vet Res Commun. 2013;37:83–9.View ArticlePubMedGoogle Scholar
  48. Brentjens RJ, Ketterer M, Apicella MA, Spinola SM. Fine tangled pili expressed by Haemophilus ducreyi are a novel class of pili. J Bacteriol. 1996;178:808–16.PubMed CentralPubMedGoogle Scholar
  49. Haikarainen T, Papageorgiou AC. Dps-like proteins: structural and functional insights into a versatile protein family. Cell Mol Life Sci. 2010;67:341–51.View ArticlePubMedGoogle Scholar
  50. Huergo LF, Rahman H, Ibrahimovic A, Day CJ, Korolik V. Campylobacter jejuni Dps protein binds DNA in the presence of iron or hydrogen peroxide. J Bacteriol. 2013;195:1970–8.PubMed CentralView ArticlePubMedGoogle Scholar
  51. Theoret JR, Cooper KK, Glock RD, Joens LA. A Campylobacter jejuni Dps homolog has a role in intracellular survival and in the development of campylobacterosis in neonate piglets. Foodborne Pathog Dis. 2011;8:1263–8.PubMed CentralView ArticlePubMedGoogle Scholar
  52. Theoret JR, Cooper KK, Zekarias B, Roland KL, Law BF, Curtiss R 3rd, Joens LA. The Campylobacter jejuni Dps homologue is important for in vitro biofilm formation and cecal colonization of poultry and may serve as a protective antigen for vaccination. Clin Vaccine Immunol. 2012;19:1426–31.PubMed CentralView ArticlePubMedGoogle Scholar
  53. Pang B, Hong W, Kock ND, Swords WE. Dps promotes survival of nontypeable Haemophilus influenzae in biofilm communities in vitro and resistance to clearance in vivo. Front Cell Infect Microbiol. 2012;2:58.PubMed CentralView ArticlePubMedGoogle Scholar
  54. Mullen LM, Nair SP, Ward JM, Rycroft AN, Williams RJ, Henderson B. Comparative functional genomic analysis of Pasteurellaceae adhesins using phage display. Vet Microbiol. 2007;122:123–34.View ArticlePubMedGoogle Scholar
  55. Mullen LM, Bosse JT, Nair SP, Ward JM, Rycroft AN, Robertson G, Langford PR, Henderson B. Pasteurellaceae ComE1 proteins combine the properties of fibronectin adhesins and DNA binding competence proteins. PLoS One. 2008;3:e3991.PubMed CentralView ArticlePubMedGoogle Scholar
  56. Mullen LM, Nair SP, Ward JM, Rycroft AN, Williams RJ, Robertson G, Mordan NJ, Henderson B. Novel adhesin from Pasteurella multocida that binds to the integrin-binding fibronectin FnIII9-10 repeats. Infect Immun. 2008;76:1093–104.PubMed CentralView ArticlePubMedGoogle Scholar
  57. Calcutt MJ, Foecking MF, Mhlanga-Mutangadura T, Reilly TJ. Genome sequence of Actinobacillus suis type strain ATCC 33415T. Genome Announc 2014; 2.Google Scholar
  58. Van Domselaar GH, Stothard P, Shrivastava S, Cruz JA, Guo A, Dong X, Lu P, Szafron D, Greiner R, Wishart DS. BASys: a web server for automated bacterial genome annotation. Nucleic Acids Res. 2005;33:W455–9.PubMed CentralView ArticlePubMedGoogle Scholar
  59. Thornton B, Basu C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 2011;39:145–54.View ArticlePubMedGoogle Scholar
  60. Darling AE, Mau B, Perna NT. progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS One. 2010;5:e11147.PubMed CentralView ArticlePubMedGoogle Scholar
  61. Van Ostaaijen J, Frey J, Rosendal S, MacInnes JI. Actinobacillus suis strains isolated from healthy and diseased swine are clonal and carry apxICABD var. suis and apxIICA var. suis toxin genes. J Clin Microbiol. 1997;35:1131–7.PubMed CentralPubMedGoogle Scholar
  62. Slavic D, DeLay J, Hayes MA, MacInnes JI. Comparative pathogenicity of different Actinobacillus suis O/K serotypes. Can J Vet Res. 2000;64:81–7.PubMed CentralPubMedGoogle Scholar
  63. Foote SJ, Bosse JT, Bouevitch AB, Langford PR, Young NM, Nash JH. The complete genome sequence of Actinobacillus pleuropneumoniae L20 (serotype 5b). J Bacteriol. 2008;190:1495–6.PubMed CentralView ArticlePubMedGoogle Scholar

Copyright

© Bujold and Maclnnes. 2015

Advertisement